Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9084  (registered. 2007)
Contig Information
Length 728 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Mannan endo-1,4-beta-mannosidase 2; AltName: Full=Beta-mannanase 2; AltName: Full=Endo-beta-1,4-mannanase 2; AltName: Full=OsMAN2; Flags: Precursor >gi|14209520|dbj|BAB56016.1| putative (1-4)-beta-mannan endohydrolase [Oryza sativa Japonica Group] >gi|21902051|dbj|BAC05600.1| putative (1-4)-beta-mannan endohydrolase [Oryza sativa Japonica Group]
Score 778
Evalue 5.06871e-81
Total Hit Count 210
Registered year 2007
Contig Sequence     [ Download ]
>Contig9084
cggcgccgagcacgccacctttcatggtatcccttcggtccatttcgtgtcgatttcctacggacacacagtaacagTACATGACATGAGCACGCAAAAA
AGCCACACCTCGCAAGACAGATCACGGGTCAGCCGCACACCGCCTTGAGGATCCTCTTGGCCTCCACCTCCCCGTGCCTCAGCGCGGCCAGCCGGCACGA
CTGCTCCGTGAGCAGCTTCTGCATGGACGGCGTTTCGCTGGGCACGATGGCGAAGCCGTCGTGGTACTCCTCCATGTCCTCGGCGGCGAGCTGCCACACT
ATCGCGCCGGCGCCGGCGCCGCCCCTCTTGGCCGATTCGTGGACGATGTCGTACACCGACTTGTAGAAGGCGTCGCGCTGCGACTGCTCGAACCCCTTGA
CCAAATGCGACAGCCCGAACTCCGTGAGCACCACGGGCTTGCCGCCGAGCTCCGTGTCGCCGTCCTCGAAGTGGGAGCTCACCCACTGCGTCACGAACTT
GAGCTTCTCTTCCAAATTCGCGTGCAGCAGCCAGGTGTCCGGGTAAAGGTGGACGGAGGCGAAGTCGATGTCAGAGATCTTGGAGTTGCGGATGAAGTCG
AGGCCGTAGTTGTTGAACCAGTGCCCCGGATTCACGCTGagCTTCTCcggtgggctcgtcgggcCGTAGAACCCCtcggtGCCGACGGTCAGCAGatgcc
gacggtcgatcgatttcacgtaccccgc
page-top