Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig879  (registered. 2012)
Contig Information
Length 994 bp
Clones alternative view 6 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_SHDr Shoot grown with dessication 2
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|194700700|gb|ACF84434.1|| unknown [Zea mays]
Score 480
Evalue 1.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig879
ATTCGATGACACCGAACAAGCACGATAATTTATTCGTGAACAATATTGGTTCACTTCACCAAGTGACAGGTTTCCTACTTGTAGCCACTGCTTGTGCTGC
TGCTACACACTAACCAACCATCTGTACCATGAGCTTGACAACATCGCGAAAGACGCCTTTTCTGAGCACTCATTTTGCGGATCTGATGAGCTCCTCGCTG
AACTCCCAGAGTTGCTTCGCCAAGACGTCGCTCTTCGCATGCTTGCTCGTCTTCTCCTCGTTGCAGTCGGCAAAGTATTTGCCTGTCACACCCTTCAGCT
GAGGGTTGAGCCCTACGTAGCAAGTAGTTGCCGCTCCCTGGGGTACATTCTTCCAGAACAAGTAGGTGACAACTTGAATTGCCTTCATGAGAGCAAAGGA
ATGCCTCATCAAATTGGTCATGATCAATCCAGGATGAACGCAATTAACTGTGATGTTAGCTCCTTCCTCCTTGAGCCGCCTGGAGAGCTCTTTCGCGTGC
AGTATGTTTGCAAGCTTAGATTGTCCATAGGCCATTTTATCATTGTATATTTTCTTGTCATTGAGCTGATCAAACAGAATCCCCTTTGGATATGTATGGA
GGTGGGCAACTGATGACAAGTTCACAATGCGACCCTCAATACCCGTAGACTTGGCAGTAGTTTTCATGTTATCAAGGAGAAGGTTGGTCAGTAGGAAGTG
ACCAAGATGATTTGTGGCAAACTGCATCTCCACTTCGTCTTCAGACAGTTGGAAAGGACAGAACATCACACCTGCATTATTTATCAAGATGTTTAGAGGA
AGATTCATGGAGTTGAACTGGTCAGCGAAGGCCCTGACAGACTTGAGGGAGCTAAGGTCAAGCTTCAGAACATCGACACGGNNNNNNGGGTGTATCTCCA
TGATGCGCTTCCTTGCCTCTGATGCAGCCTCTGTGTTTCTCGCAGCAATGATGACATGGGCTCCTCTCAGGGCAAAGACTCTCGAGGTCTCTAG
page-top