Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8788  (registered. 2012)
Contig Information
Length 654 bp
Clones alternative view 57 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 6
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
Wh_CSEC Callus 5
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 1
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_MS Seed DPA5 of DT3DL CS wheat 4
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 1
Wh_VSCB Liquid cultured tissue 2
Wh_VWD Shoot grown with dessication 2
WH_XI Two-week old seedlings(22℃ 16L-8D) 4
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 3
WH_XB Root 3
WH_XD Root, treated at 50 microM Al for 6h 3
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115441855|ref|NP_001045207.1|| Os01g0918300 [Oryza sativa (japonica cultivar-group)]
Score 181
Evalue 4.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8788
TTTTTTTTTTGGGAACACAACAAGGCATGATATATTAGGCAATGGATGATAGTTCAGTCACGACATCAACAGTACTCCGATGTTGTTTCACCTCCAGACC
CCCCCTCAGGCTATGGCACAGAACCATAGCCTCACAAGTTCTTTCACTTCTTACATTTTACTCTAGTTCTAAAGGTAGCATACGACATAGAACAGCCAGG
CTGCAGCAAGCTCCTTCTAAGGGCCAGGAAAGCACCCTCCGGTCTGGTGAAGCATGGCGTCGATCTCGTCGCCTTCCTCCATCTCAAGCTCATCAGGGGT
CTGCTCACCACGGAGCCTACGACCATCAAAAAGGAAAGCAATGGAGTTGAGATCCACAGACTGACGGTCGCAGTAAGCGTTCATCAGCTTCTTCAGCTGT
GTGGATCTCTTGATGCGGAAGAAAACCTCATTGCCATCCTGCCCCTTGACCTTGAGGTTGATGTGGGCGCCTCCACCGTCGCCCGCGGGCTTCTTGTCCT
CGTCCGCCGTCACTCCCGACATCTCCGCCGACTCCTCTGTGCTGTGCCGCGCCGCGCCGCGCCGCGAAGGGGGTTGAGGAGCAGGGTATGGGATCCGAGC
AGGAGCAGAGGAAGAAGATGACTCGAGTCTGTGCGGCGGACCCGAGCCTCGTGC
page-top