Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8997  (registered. 2007)
Contig Information
Length 1057 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_22743 [Oryza sativa Indica Group]
Score 571
Evalue 9.65452e-57
Total Hit Count 446
Registered year 2007
Contig Sequence     [ Download ]
>Contig8997
ctatcttatactctccctctgtcccataataacgctcatatattatgggatactctccctctgtcccataataacgctcatatattatggaacggagtga
gtatttctttgcggagagagtacatggacctgccctgcgagtaccaccgagaccttgcaggtttcaactcgtgggccaaagcataaattcacgtatagaa
ggatctgcgttgcactgttctacctgtatagcctgaacaaattatttactccatggacgagaaacggacaggatgtaccactacgagtatatacagtgcc
ttccatacacaggcaaaggtaacggcgtgaagttctgatgttcgacaggagaactcctagcccaaagacaACACAACGATCGTTCATGACAAGG*AACCC
GTG*ATGACCTGAGGCATGACATCTCCGCTGTCGTTAGGTTTACAGTTCTCCTTTTTGGAGATTTACGGCAGCAGACTGAAGTTTCTGTGGATTATATAA
GTTGGCAGCAACCACCAGCCGGAGAGAAAGTTATGGTGGCTCCCTAAGTAAGTACTTCTCTTCTCAACTGCTTCCCTTCTACAGATGTAACCGGCTGAGC
AAGTACGCCAACCCGATATTTCTTGCATGCTCCATACTTCCATTGTCGGCATGAAAATGAAGCACTGCCACCGTTGCCGGCTCCTCCAAACGCCCATCGG
TGTAGGCATGCTTGTAGAAACATCGACTGCCAAAGGGGCAAGTGTCCCTTCCAAAGTCAAAGTACCTACAATCAATCGACTTGAGCTTGGCCTTGTAACC
GTCAATTATATCCTGTTTTTCCTCCTTCGAGGAGTACCATGTAGCACTAGGAATGACATAGTACGAGACTTTGCGGCATATTGGACAAGCCTTGACTGTA
GAGTCGATATCCATAGAAGACGTAAGAGAGCTGCTGCGCCACTTCCTAATGCATGTGATACAGAAGGCAtggtcaCATTCAGGTagaagcccaaacctct
tttccgctgctgtgggctttgaaagcacacggtccaaacatacactacattctatcc
page-top