Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8781  (registered. 2012)
Contig Information
Length 782 bp
Clones alternative view 56 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 3
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_OKCS Seed DPA5 2
Wh_RDr Root of dessiccated seed 2
Wh_V483 Shoot grown under cold condition for 3days 3
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 4
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_SP 5
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 11
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115483941|ref|NP_001065632.1|| Os11g0127900 [Oryza sativa (japonica cultivar-group)]
Score 285
Evalue 3.00E-75
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8781
TTTTTTTTTTCCAAGCAATTAAGAAAACTTTATCTTAACGTCCAGTCTCATCATTAACATAAGATAAACATAGCATAATCCCTTTAACTAGGCATGAAGC
AAAATGATATTGCACGGGCACCTCAGAATCCATTTCATCGACCAAAAGATGGGAAACTACTAGCAGAAAATGTAGATAGATAAGTAGACAAGCAGTACGC
CACCACCGCCATACCCAAGAGGACTTCTCGCAGAGATCAACGGTAAGACTTCTGGAAACGCGCGCGGGCGCCACGACCGCCGAACTTCTTGGGCTCGCAA
CGGCGCGGGTCGGCGACGAGGAGCGTCCGGTCGTAGCGGGCGAAGATCTCCTTCACCTCCTTCTTGGCCGCCTCGTCGACGTACTTCTGGTAGTAGGCGA
CGAGGGACTTGGCGATGGCCTGGCGGATGGAGTAGATCTGGCTCGTCTTCCCGCCGCCGCGGACGCGAATCCTCATGTCGATGTCCTTGAAGCGCGACCT
ACCGGCGAGCAGGATCGGCTCGAAGGCCTTGAGGCGGAGCATCTCGGGGCGGATGAGCTCGATGGGGGCGCCGTTGACCTTGATGAGGCCGCGGCCGGGC
TTGCAGTAGGCCACGGCGACGGCGGTCTTCTTCCGGCCGAAGCACTGGACGGTGCCCGGCGTCGGGCGGGTGAGAACGGCTGCCATGGTGGCTGCGGCGG
TGTCCTGGGATTGCTGTGAGCGCGGTGGTGTGCTTGGTTGCGGCTAGCGCAGCGGCGCGGCGGGGTTTTCCTCGTGCCGAAT
page-top