Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8929  (registered. 2007)
Contig Information
Length 633 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Histone H2B.5; AltName: Full=wcH2B-6 >gi|531056|dbj|BAA07156.1| protein H2B-6 [Triticum aestivum]
Score 444
Evalue 2.00275e-42
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig8929
cgaggggcAAACCCGCAGTCCTCCCACCTCGCGCCCCCAAATCCGATCTCGCGCCTCCACCTCCGCCGAAATCGCCATGGCGCCCAAGGCCGAGAAGAAG
CCCGCAGCGGAGAAGAAGCCGGTGGAGACGGAGAAGAAGCCCAAGGCCGAGAAGCGCGTGCCCGGCAAGGACGGCGGCGCCGACAAGAAGAAGAAGAAGG
CCAAGAAGAGCGTCGAGACCTACAAGATCTACATCTTCAAGGTCCTGAAGCAGGTGCACCCCGACATCGGCATCTCCTCCAAGGCCATGTCCATCATGAA
CTCCTTCATCAACGACATCTTCGAGAAGCTCGCCGGTGAGTCGGCCAAGCTCGCGCGCTACAACAAGAAGCCCACCATCACCTCCCGGGAGATCCAGACC
GCCGTCCGCCTCGTCCTCCCCGGCGAGCTCGCCAAGCATGCCGTCTCTGAGGGCACCAAGGCCGTCACCAAGTTCACCTCCTCTTAGATCTCCAGCCGCC
GCGGAGTCTCTGTTAATTTTGGTCTTGTCTGCTTTATTCGTGTGGCAAACAAACATTATAGTGGGTTGGATCTCCCTATGAAACAGTGTATAATGAGTCG
GAattgctgaattaatgaaacatctagtggttg
page-top