Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8868  (registered. 2007)
Contig Information
Length 718 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_00610 [Oryza sativa Indica Group]
Score 146
Evalue 9.40907e-08
Total Hit Count 137
Registered year 2007
Contig Sequence     [ Download ]
>Contig8868
cgaggcctccaccaaaaactagggttagggttagggcggcggcggcggctttatttccgatcgcgatcgccatggccaccggagGCGCCCCAAAGCCGGA
GGAGGAGACCGTCGTCTTCCCCGATTGGGTGATGCTGGAACGCATCTTCCGCAAACGGTGCCACGACGACCTAGACGCTGCTGGTGAGGCCGTCAACAAG
AACAAGACCGCCGCTCCAGTCAAGATTGACAGCGGCCACTCCTGCTTCGTCTCCTTCACCCTCGCAGCTCCTCCAGGGTCCTCCTACTTCAACCTCCATT
GGCCGGAGAGACAAGGCTCAGAAGAACTCCTTGCCTTCGTCCGGGCAGTCGACAAGAACCTTGTCCTCTTCGACATCTCGATCCCCGACCGGATTCGCTA
CTTCGACGCTCCGCCAGATCTGTTCGTCTACACGGCCTCTGCTCCTCCCCCCCCGGTGCAGCAGCTTCCTCGGCGCAGCACAAAGCAGTTCCTGGCTCAT
CAGTTCACCACCGGCATTCTGCAGCTCAAAGCGGAGCACTGCTACATCGTTGCCGACCTCAATGTCCACCTCAAGAAAGAGGGCGCTAGTGCTGAACTCT
GTGTCTTCAACTCCGGCGCCACCGATTGGAgaatcatcaccgaggtgcttgctgataagctccctgacctctggtttaccgatgatgtgtttgctttcga
tggccgtttcctttgctg
page-top