Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8765  (registered. 2012)
Contig Information
Length 1294 bp
Clones alternative view 33 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 2
Wh_KMP Shoot grown under continuous light 1
Wh_VSCB Liquid cultured tissue 2
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XA Root 2
WH_XB Root 6
WH_XE Seedling, infected with leaf rust 2
WH_XF Seedling, infected with leaf rust 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125539847|gb|EAY86242.1|| hypothetical protein OsI_07611 [Oryza sativa Indica Group]
Score 610
Evalue 2.00E-172
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8765
TTTTTTTTTTAGCAGAATGGAGCAATCTTTATTCGTTAGATAAAAACTTATGTTCATCATAGGAAGCTGGATCAGCAGACTCGTCTATATACTCAACCCA
AACAACAAAGTTTTGAGTCAAGGATCCCGTTACTACGGAATGACCAAGCAAGAATCAATAGTATCTTCTTACAACGATGGACTGAAAAGAAAAGAAAAGA
GAATACTCATTTCCACAATTGCTTCTTTTCCAACTCAATAAATGAGCTGAGATATTGTACAGCCGAGGAATCCAGAAGAAAATAAAACTTTCCGTTGGGA
AAGTCAAAACAAGGGATGAGCAGAGAAATGCTACCCGAATAATTCGTGTTTTCAATCCAGACGTTGCTCCCCTAAAGCTCTTGTCGATATATCAGTTTGT
CCATGAGGCGGACCTTCTCAAAACTGGCTTCATTGCCTTGTCCTCTTCCAAGGCTATCATACCAAGATGCGAAGGATCCTCCAGCAGCATCTTGGCGACC
AAATACCCGGCAATGGACCAAGTCTGAAATTTCCTTGCCTGCTTGCCAACATATTTTCCAAGCTTACCATCGTAATACTCAGGCCAGCCATCCTTCAACA
GCCTCCTCTCAGCTAGGTCAATTGCTCTTCTTGCAATTTGCGGCCGTCCAGTTTTGATGCTTGCTGCTGTGAGCAGCCAGAGAAGTACTGGCCAAGATCC
TCCATTGTGGTAACTCCATCTCGTATTTTTTGGATCACATCCCGTCACGATACGCCATTCATGGTTCTCAATAGCAGGATAGCATATCTTCAGAGGCATC
TCACCAATTAACTCTTCCCAGCGCTCCTCAATGAGATCCATTATGGCCATGGATTGCTCAGGTGTAGCAAGAGATGATACTATGGCAATCATGTTTCCAA
GTGCAAACCAACGGAAGTCCATCCTTGCAGGACTGACATTACCAACAAAAAAACCACCCTCGCAAGGCATGAAATCAAATAGCCAGTCCGGAATAGAATC
TGGAATAACATTAAATTTGTTGACAGCTGTATGAGAATATTCTTCCGTCTTGTAACGATAAATATCATTTAGCTGCTGGAAATCTAGCCAAAAATAACTC
CGCATGTGATAACTTAAAGCATGAAGACGAGTTGCAATCCGCTCCACAAAATCTTTCCCTTCAGCGTCATGTTTAAGCATTAGAAGAGCACACCTTAGTG
CCATGAAGAAAAGGGATTGAATTTCAATGGGGTAGCCATACACACCCATCCTACGATCTATCATGCAGCAACCATCAGCACATAACAATGTCGG
page-top