Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8767  (registered. 2007)
Contig Information
Length 877 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_09541 [Oryza sativa Indica Group]
Score 639
Evalue 3.78641e-76
Total Hit Count 42
Registered year 2007
Contig Sequence     [ Download ]
>Contig8767
acgagggtgctgatgaccgtcgccgacttcagcgaccagtacacggactaccaggacaagctgttccgcaacgacgacggccgcctcgagttcgccggcg
acaactgggccgcgctctggccggggaccggaaagcccgggctgtggatgagcgccatgtccaggctcgccgcgctgtaccgcctcatcgccaccgacga
gcagctccgccacatggaacaagaggggtcgacgaagacggcggcaggggaCGAaca*gGACGAGGGGCTGGAGCTCTGCATCCCGCCCGTGTTCGACCG
GTGCAGCAAGGTGCTGGACCCCGGCGAGCAGATCGCGGCGAGGGACCTGTACTGGGAGGCGATCTGCAGCGACGGCAAGGAGGGCGTGGAGTCGCTGCTG
CGGCGCTGCATCGTGAAGAACCCGTACGTGGGGGAGCCGTGGCTGGTGCTGGCTCAGGTGCTGCTGAACGAAGGAGGGAGGTGGGAGGAGGCGGAGGCGG
CGGCGGCGGAGGGGCTGAGGCTGGTGCTGGAGTGGGGCAGCAGCTGGGACAAGAGGATGTCGTGGGaggggttgGGTGTCGtgggggagggtgatgaggg
acaaggccaaggagaaacaatggccgcgctctgcctggggcatcatcaacctcggactcgtcgagcagatcaacgaccacaactagctGCCGTCATTTAT
AACTCGCTCGATCACTCGATCAGTTGTGGTGCTTACTTAGCGCGAGTTTGTCTTCATTAATTAGCTGTGTGATGGTGTGGTACCTGAGTATGTGACCTAT
ATATATTTCTGTCATTGTGTGGTGGTCATTAGCGTGATGTTgtggtatctgagtgtatgtacctatgtttgctcgta
page-top