Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig876  (registered. 2012)
Contig Information
Length 1282 bp
Clones alternative view 16 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_CSEC Callus 1
Wh_EM Dormant seed with water absorption 1
Wh_V483 Shoot grown under cold condition for 3days 1
WH_XT Roots, 18 day old plants were grown hydroponically 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115471679|ref|NP_001059438.1|| Os07g0408700 [Oryza sativa (japonica cultivar-group)]
Score 617
Evalue 1.00E-174
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig876
ACCACCAGGTAACCAGGAAATACAACCTGAGACATACAGCAGACAGAATCACAGGTACCAATAATTTCCATGTGGGCTTATTGCAAGTTAATAAAAAAAG
GGGGGGCTTTTCCTCTGTCTACGCTCAGACAGATTGCTCCCAGTGTTGAAATTGAAACCAAACCAGTTATTCTAGTTGGCCTTGGTTCCAGTGACCATCT
TCATGAGAATCTAGTTAGCCTTGGCCTCAATGACCCTCCTCGCAAATGATGGCAAACAAAACGATGCAGTGTGGAACTCAGAATTGTAGAACTTGAGCGG
CCCCTTGGATTTTGTGGAGTATTCGTCCTCTTCAATGCTGAAGACAGGGTGCTGGAAATCAACACTAGGCCCCTCCGTGGAGCAGAGCATGAAACCTATC
ACTCCGCTTGGGTATGTGGGCACCGTAGTCCATGCGTAGTTCACCGAGCCTTTGAAAACCTGGCGACAGTTGGTGACGATGTCCTCTATGATGTGCATGT
GCAGCCATATGCTCTCCGCCTGGGTGCAGACGACCCCGCCCGGACGCAGAGCCCTGGAGACGGACTCAAAGAACGGCTTCTCGAACAGCTCCTGGGCAGG
GCCTACTGGGTCGGAGGAATCGACGATAACCGCATCGTAGGTGCCCTCTGGAGCATTCTTCAGGAAGGCGACGCCGTCGCCGATGTGCAGGGAGACGCGA
GGGTCCTCGAACCCGAGGGCCAGATGAGGGAAGAACTGCTTGGACACATCGACCACCATCTTGTCGATCTCGCAGATGTCGATCTGCTCCACCGAGGAGT
GCCGCGAGACCTCACGCAGAACGCCGCCGTCCCCGCCCCCGATGACCAGGACCTTCTTGGGGTCTTTGATTGAGCAGAGAGGGAGGTGGGTGATCATCTC
CTGGTAGGCGCACTCGTCCCTCTCGGTCACCTGGATCACCCCATCCAGGACGAGCACCTTCCCGTAGGTGGAGGACTGGAAAACCAGCACGTCTTGGTAG
TCCGACTTGCCTTGGAACAGGACCTTCTCCACCTTGAGCGAGTGCGCCTCGCCGGGCCACATGGGGCTGATCTCGGAGAACCATCCGGGGATGACGGCGG
AGATCCCCGCCTGCTCCCCGGCTCCGTCCGCCGCCGCAGCGCCCTCGTTCTCCCGCGCCCTCTTCGCCGCCGTCTCGGCCTCCATCACAAAAGCCTAGAG
CGCGACGACGGCGAGACGAGCTCGGCGGCTTGGGTGGATTTCGTCGGCGGCGGCGGCGGCTAGGTGTAAGCTAGGGAGGGAT
page-top