Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8649  (registered. 2007)
Contig Information
Length 306 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit predicted protein [Laccaria bicolor S238N-H82] >gi|164643538|gb|EDR07790.1| predicted protein [Laccaria bicolor S238N-H82]
Score 85
Evalue 0.415087
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>Contig8649
ttttttttttggagataatgTTCCtgg*acAAATCTTTGATGattcacCGTTACAAAGATACACCGCAGATGATAATCTCTGTAATAACCAATTCATACA
TTGCCAAGTAAATCTTCTCCTGTGCCTGCATCACACAGATCACCAACAGAAACACACCCAGTATCCATCCATCCAACCCGAAGGCGAACATCGAACGACG
ACGATGAAACGCGACACGATTACATATAATCCGCAACGTCCATAACACCATCTGTAATGTACAAGAGTTTATAGGTTATTCCTTTATTCAGACATAACAG
Agcctt
page-top