Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8577  (registered. 2007)
Contig Information
Length 305 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 1A family penicillin-binding protein [Caulobacter crescentus CB15] >gi|13421383|gb|AAK22239.1| penicillin-binding protein, 1A family [Caulobacter crescentus CB15] >gi|220962363|gb|ACL93719.1| multimodular transpeptidase-transglycosylase PBP 1A [Caulobacter crescentus NA1000]
Score 83
Evalue 0.708032
Total Hit Count 13
Registered year 2007
Contig Sequence     [ Download ]
>Contig8577
ttttttttttcagcagcactacatgaacataatAAAAAAGATGTACcaaatcTGAAGGTGCTACGATTGATCTACTCATATTTCCCCTGATTTGAATAGG
CGGGTGCTAGGCGCCGGCGCACCGGCCCAAATTTGGGCCGGTCACATCAGCACCGTGCGATTCAGAAAATTAGAGCCGCCCGATCTTTTTCCTTCTTCCC
ctgtgtcttcttctctaggaaacatccccatcgcgccgtggacgaacgatgcgcctgccctagaagcaccgcccgactcatctcgccggncgncacccct
cgccg
page-top