Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8410  (registered. 2007)
Contig Information
Length 698 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Serpin-Z7; AltName: Full=HorvuZ7; AltName: Full=BSZ7 >gi|1197577|emb|CAA64599.1| serpin [Hordeum vulgare subsp. vulgare]
Score 651
Evalue 4.55548e-87
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig8410
cgaggttctcgagtctactacaagtccaacgaaccaccaccccggccatggcaaccacccttgccaccgATGtccgcCTCTCGGTCGCGCACCAGACCCG
ATTCGCCCTCCGCCTCGCCTCCGCCATCTCATCCGACCCCGAATCTGCTaccagcAACGTCGCCTTCTCCCCGGTCTCACTCCATGTCGCGCTCAGCCTC
atcacTGCCGGCGCTGGCGGCACCACCcgtgaggccgtgacCAGCTCGTAGCCATACTTGGGAACGAGAATGCAGGCGGGCCCGAGGGACTCCACTCGCT
CGCCGAGCAGGTGGTACAGTTAGTGCTTGCCGATGCGTCCATCACCGGCGACCCGCGCGTCGCCTTCGCCAACGGCGTTTTTGTAGACGCGTCGCTCTCG
CTCAAGCCTTCCTTCCAGGAGCTCGCCGTGTGCAACTATAAGTCTGAGGTCCAATCCGTGGACTTCCAGAATAAGGCTCCTGAAATTGCTAGTCAAGTGA
ACtcatgGGTAGAGAATgtgacAACAGGTCTCATCAGAGAGATCCTCCCTGAAGGGTCTATTGACTAcaccaCTAGACTGGTTCTTGGTAATgcccttta
tttcaagggactttggactgagaaatttgacgaatctaagacaaaatacgacaagttccaccttttaaatgggaacactgttcaaacaccattcatgt
page-top