Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8013  (registered. 2007)
Contig Information
Length 714 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0252100 [Oryza sativa (japonica cultivar-group)] >gi|113630918|dbj|BAF24599.1| Os09g0252100 [Oryza sativa (japonica cultivar-group)]
Score 554
Evalue 4.60514e-55
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig8013
ggctgcttgacccccgctcccgcgcctcgtgcactccgcctccgccgccgccagatccgacgaccccaggcacgccccctccctccctctctctctttct
ctgcattttcttggcctgatgcagatggtcgtcaataatcgcggaccgctccttggcgccgccggcgtggcagcgacgtctgtcgtcccccctctggacc
gcgcgtgacgcgacggctgcttgcctgatcccgcggcgacactgaaccggagtttgtttttgttcgcctgactaattttgCAGGTCGGAATCGGGGAGCT
GCCATGGGTTCACAGAACATCGGCCCCAGAGATGTCTGCATCGTCGGGGTCGCGCGCACCCCTATGGGTGGTTTCCTCGGCGCCCTGTCTTCCTTGCCTG
CTACCAAACTCGGCTCCGTGGCTATCGAAGCTGCTCTGAAAAGGGCGAATGTCGATCCATCCCTTGTGCAGGAGGTCTTCTTCGGCAATGTCCTGAGTGC
TAACTTGGGGCAAGCTCCAGCGAGACAGGCTGCCTTAGGCGCAGGGATACCGAACACGGTTGTTTGCACCACTGTCAACAAAGTTTGCGCATCTGGCATG
AAAGCAACGATGTTTGCTGCACAGTCGATTCTACTGGGCAGCAATGATATTGTAGTGGCAGGTGGCATGGAGAGCATGtcgaatgctccgaaatacattt
gctgaagctagaaa
page-top