Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8678  (registered. 2012)
Contig Information
Length 971 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_VSCB Liquid cultured tissue 1
Wh_VWD Shoot grown with dessication 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XV Leaves, plant was grown at constant 23℃ 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115448365|ref|NP_001047962.1|| Os02g0721700 [Oryza sativa (japonica cultivar-group)]
Score 258
Evalue 6.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8678
TTTTTTTTTTGACCAAAAAGAAAAAGTTGTCATCATTATACACGAGTGAGACATAATACAGTGTGAGAGGTATGATACAGTGACAATCAGTGAATTCTAA
GTTGGCAACCAGGTGAGATTCCAAAGAATATGTAATCTGACATAGCTTCAAATTACAAGATATTGCAAGAAGGAAAATTTCAAGAGCGCCTTAAGGAGCA
GCAGCGGATTCAGGCTCAACATCATTTGAAAAACATGGGAGAAATAAAGGTATCACCACCACCACGGCACCGTCTATTGGAAGAACAATGCTACTAGTCC
ACACATGAGAGTAATCAAAGCAAGCGAGCTGCTTCGAGCCCTTTGGACACCACTTTTAACGACGTCTTTCTGGGGGACGCCTTCGCAAGAAAGACCTAGC
TTGCCTTCTCGGCACTCGTGGGCAAACAGGCCTGGTGGGTACTTGCCATAGAGGTTGATGTAGCTGAACATTGTGGATGCACAGTCATTGCTTTCATCAT
TGATGTAGTTATTAAATGGGCATGCAAATTCCTTGAAAGAATCACAGCAGTCTTTAGGAGGATATTTTGGCCCTTTGCACCTGCTTGTGATGACGGTGTA
GTTTTGGAACTCGAAGTTCACAGGACAATCCCTCTTGGCCTGCAGCAAGGTCCTCCCCGTAGTAGATCCGGCGCCCGCCTGGAACACGCCGTCGGAGATG
AAGGGGGAGGCGGAGGCGAGCCCGACCAGGAGGGCGGCGAGGACGAGGAGGAGCGGGAGCCCACGGCCGGTGGCCATCGTCGCGCGTCCCTCCGCCCGGC
GCACGGCTCCGAGCAGGGACAAAGGCTGTTGGATCTAGGAGGACGACGACGACGGACGGCGCGCGCAGACCCACCCACGTGCGCGCCTCGACTCTCCTCG
CTGGTGGCTTGTAAGCTCCACGGAGCGGGCGGGCGGTGCTACAGCTGCAATTAATTAGTGGCGACGGATGC
page-top