Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8677  (registered. 2012)
Contig Information
Length 1017 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|229609775|gb|ACQ83503.1|| CBL-interacting protein kinase 03 [Sorghum bicolor]
Score 312
Evalue 5.00E-83
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8677
ACTTAAAATTACCCGGTGTCCATATAGAAGAACACATGCCTACATATCAAACAATTGAATGGCCTACACACTAAGCCAATAAGTGCATGCAAATTGCACC
CGGTGCCAGTGACACCGGGTAGCTATACGTAGCTTCGCCCCTGACAATGGGAACGAAATGATGACCGGCCGATGTGAGTTTACAAGCATATTCGGCTAAA
TGTTTGCGAGTTCCTGATTGCATTGTTGTTCCAAAGTGAACTTGATACGGCTTGTGAAAACCCACATGCCTAATATACAGCAAAACCTACTTGAATGTGC
TTGACTTAAACTGTTCCAACAAGTCTCTCAAAATGCAGCATATACAACACCAGTGGAGGACAGGCACGGCTGACAACAGGGCTATCCACCTGTACTTACA
AAATGCGGTGAACAATTTATCTTGATCCAGCTCCTGAGAATGGATCAACTCAGGAAGAATGGGATGCTAATAGTTTACCCATCCCCCCTTCTCCCAAGCT
GCTGCTAGGAAGGTTGGATCTGAAGATCGTCGGATTTCCATACAACGTCCTTCAAGGTGTTTGAAAGGTTCTTGTAGAACTTGTGAAATTCTAGAGTGTC
GCCTTTTGCTTTGCGAACTTCAACCATATGAAGAGAAGGCCCGACTCGCAGTATCTCGGTAGCAACATTGAGTTTCCCCTTCCTTCCTGCTTTTACCTTC
TCTAGTCTCAGCTTGTAATTTTTCTTGTGAATATCAAATCCTAGAGGCTTTGCAGCTTCTTCGATCTTGCGGAGAATTTCTTTAGGCGAGCTTTTAGATG
TAAACCTTGTTTCTCTTTTAAATTCTTGCTCAGAGTCGAATAAATTTCCAAGATTAAGGCCTGCTGACATTGAAATCAGTTCAAATGCATTCAGAGCTAC
TGGTTCTTCTTCTTTCTTTTCTGTTACATGGTGCTCTTCTGAATCATTGAAGACAGCATCCACATCGTCCAGTGTTGTGTCATACTTCTCATCAAACTCC
GCACGCTTGTAACCTTT
page-top