Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8674  (registered. 2012)
Contig Information
Length 595 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_yd Spikelet at late flowering 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|291410763|ref|XP_002721657.1|| PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]"
Score 209
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8674
CACCAGCAACACACACACAGCAGCCCAGCCNNNCTCGCCGGAGAAAGAAGAGTCGAAGATGTCCGGCCGCGGCAAGGGAGGGAAGGGGCTGGGCAAGGGC
GGCGCCAAGCGCCACCGGAAGGTGCTCCGGGACAACATCCAGGGCATCACCAAGCCGGCCATCCGCCGTCTGGCGCGCAGGGGCGGCGTGAAGCGCATCT
CGGGGCTCATCTACGAGGAGACCCGCGGCGTGCTCAAGATCTTCCTGGAGAACGTCATCCGCGACGCCGTCACCTACACCGAGCACGCCCGCCGCAAGAC
CGTCACCGCCATGGACGTCGTCTACGCCCTCAAGCGCCAGGGACGCACCCTCTACGGATTCGGCGGCTAGGCCGCGCTGGTCCAGGCCAGGAGGATCCGT
CTTGCACCACCGGATTAGTGCTAGTAGCTACGCGTTGTCTGGTGGTGGTGTTCATGGCCTCGGTGTAATGGCTGCATCTCGCTGTTGTTCGCGCTGGACT
TGTTTGTTGTTTGGGTGTACAGCATTTTACCCCTGAATTCGTATGGAATCTGTGGCTCTGTCGATGTTTGTTCGTGCGTGCGGTCAGATATTACC
page-top