Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7875  (registered. 2007)
Contig Information
Length 1059 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_03346 [Oryza sativa Indica Group]
Score 1019
Evalue 1.09189e-108
Total Hit Count 378
Registered year 2007
Contig Sequence     [ Download ]
>Contig7875
caattgtatacaatgaaacaatatgttcatcacatgcttcgcaatgtggattttggttatacaggcacttgcacaaatatttacatttccatgaaagata
aatgtcctcgttctcctcataagctcgaaaattgacccttctgttacggaactggagatgaccagaacgaagcagcagagaccaaaactgctcccttcct
ggtagtactcactaacgacgacgacttgtggatcacgcgctttatgtccaatgaaaagggccccttgaaccataccatgtcccagcaaagcaaatcacac
cctataggttcctggcttcgttgcaaatgacatgcagcagaactctatgtataGCGTTTcttaaacAGCGTATGCCTCTTAgccgggtcCTTCTTCTTGG
CTCCCTTGCCctttccagtGTTGTACTCCATGTAGACCATTCCACCCGCTCCAGAAAATGCGCTCatcaatCCAGCAGAGCGCCGAgccttcaggagAGC
CTTGCCATCAGAATCCTCTTCCAAGTGCTCAACACCAATCATGTCATCCCCTgcgctCAACACTTTGCCTAAAAGGTCAAGCTGTTCATCGAGCGTGTGA
AAACTCAGGTTAGGTCCTTCTTCAGGTGGCGGCAAGCTAGTGATCACCTTGAAACTATATCCCTGATCGATAagaaatTGTTGCcttttggttgagtaAT
ACATTTCCTGTGTGTCAGTTGATACAAGAgaatagaaaaaggcattgtattcctcttttccacctgccatcctatcttgatgcttaccctttgccctgag
aatacgtcccaaccgttgagcttcttgacgcctggaaccagcatgagatgatatttgaatgatgacatttgcctctgggatatcaatggagttatcaccc
acctttgagaggaaaacagtgttgacttctggactgttcttgaattggtacaaaattcgtgtcctctctgcatggcttgtggcaccataaatcattggtt
tacggagcttcattgcgtatgcagttagtgcaaataaattatcagcaaatacaatcctc
page-top