Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8673  (registered. 2012)
Contig Information
Length 773 bp
Clones alternative view 12 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|32478662|gb|AAP83583.1|| cytosolic glyceraldehyde-3-phosphate dehydrogenase [Triticum
Score 249
Evalue 2.00E-80
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8673
GCATTGTTGAGGGTTTGATGACCACAGTTCATGCCATGACTGCAACCCAGAAGACTGTTGANNNNNNNNNCAGCAAGGACTGGAGAGGTGGAAGGGCTGC
CAGCTTCAACATCATTCCAAGCAGCACTGGTGCCGCAAAGGCTGTTGGCAAGGTGCTCCCAGAGCTTAACGGAAAGTTGACTGGAATGGCCTTCCGTGTT
CCCACTGTTGATGTTTCTGTTGTTGATCTGACTGTTAGACTTGCGAAGCCAGCAACCTATGATCAGATTAAGGCTGCTATCAAGGAGGAGTCTGAGGGAA
ACCTCAAGGGCATTTTGGGTTACGTTGATGAGGACCTTGTTTCCACTGACTTTCAGGGTGACAACAGGTCCAGCATCTTCGATGCCAAGGCCGGGATTGC
TGAACGACAACTTTGTCAAGCTTGTCTCCTGGTACGACAACGAGTGGGGATACAGCACCCGCGTGGTCGACCTCATCCGTCACATGCACAGCACCAAGTA
AATGAGAGGCATGAAGATACAGGGGAGAGTGGTTTGCCCCAGAGGAGTGTTCAAAGCCTCTTCTTCTGAGAATAAATTTTTGTATGGAATTATGTCAGCT
AAAAACCTTTTATTGGATGTATCCTGATGGTTGGTCACATTTTGGTGGTATTATGTACTTGCTTGAACTAAATCATGAGTCATTTTCACTCATCTTCTTT
GGTTATCAATCACATGTCATTTCGTTCTCTTGCGATTGGAAAGTTATCTATGGTTATGTTGTCAAAAAAAAAA
page-top