Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8672  (registered. 2012)
Contig Information
Length 714 bp
Clones alternative view 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 1
WH_XB Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242066520|ref|XP_002454549.1|| hypothetical protein SORBIDRAFT_04g033120 [Sorghum bicolor]
Score 151
Evalue 7.00E-35
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8672
AAGACAAAGACATAACTTCTGCACAAAGAGCACAGTTTACTTTTAGGCAACAAGTCTCTGTTTTTCCGACGGGCTATGCTCCGGCACGCGTCGATCTCCG
GCACCAGCCCATGAGAATGGAAAAGACCAAGCCTATCCATTCCACCTTACATCACCGATTCACTGTTTTGAAAGAACCATGACGTTGAAGTTCAACGAGT
TAGGGTTCGTCGCAATTCTGGCCTTGATGACTTTTGCAGCATCCTGCAGCAAGGTCTCAGGTGATGAAGGGCCATGAGATATCGGTTTTGATTTTCGTCC
ATCAAGCTCATAAAGTTCACCATCAACACAGGAGAAACAGACAAAATGTTCATTCACCTCAACGTTTACGTCAGTGTCACCAGCAGTAGCAGCAACAGCA
TGAGCACCCTCCCCTCGTGCCGAATTCGGCACGAGGCCTCCACCTAGGGTTTTGCTGCCTCCCTCCCCCACCGCCGCCGTCGCCGCCCGCGTCCACCATG
GCGCTGCCGAACCAGAACACCGTCGATTACCCCAGCTTCAAGCTCGTCATCGTCGGCGATGGCGGGACTGGCAAAACCACATTTGTGAAGAGGCATCTCA
CTGGAGAGTTTGAGAAGAAATACGAGCTTGCGGCTGCAGCGGCACANNNNNTGCCCGACGACGATGACGATCTGATCGAGTNNAGAGAGGATGATGAGTC
TGTCTGTCTTATCA
page-top