Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7862  (registered. 2007)
Contig Information
Length 791 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_26204 [Oryza sativa Indica Group]
Score 618
Evalue 2.11124e-62
Total Hit Count 74
Registered year 2007
Contig Sequence     [ Download ]
>Contig7862
acaatcgtatccgcccgatacaggggcaattctggcccaaaaacgttgccagtaaacATTACatttgggtCGATATCAATAATATACATACATAACAGCA
CAATGATCAATTGTACATATACACCATCTAGCGCTCTAGCTAGGCCCTAATTCATAACCTAATACTTCACCCTTCTTATCAACCACTGCCATCAGCTAGA
CAATCAACAATGTTCCTCGGGGGGGAGGCTTAGACACTCAACAATACAAGAGAAAAATTAGACTGCTAAGGTCAGTCTgttattcatttGCATCAGCTGG
ATTCCAGATTGAATGGCTGCAGCAGTTGAGCAGACTTTCGCCTTCGCTTTCCTTCAGGAGTCAATCTGACTGCTGCCTTAACTGAAACCTTGCCATTTTT
AGGTGGCTGCTTCTTAGACGAATTTGGTTGTACCCGAGAGGGCTCGCCCTCTTCACCACAACTTCTTTGAGGGGACTTGACTCTCTTGCGTGCGAAACGT
GCCTCCATCTCTGGTCTACGGTTGGGACCAATCAGCTTTACATGGAATGGATTCACAGC*TGTGTAGCAAACCAAGTCATTTGTAGCTTGTCCTTTGTCC
AGATCAACACTTCTGCCGTTCACCAGCTGGAGAAGGGCAGAGAATGTTCTTGCAACCTcgtacttt*gGTTTGCTGCTAACAATCTCACTGAATGATGCA
ATCCCTGTATCAGTTCTTGACGag*agTGTGTCAAGGATCTGCTCTCCATATAAaccaatatcaaagggtgggtttctatcctcgtgccga
page-top