Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8670  (registered. 2012)
Contig Information
Length 908 bp
Clones alternative view 13 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_EM Dormant seed with water absorption 1
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|108707535|gb|ABF95330.1|| expressed protein [Oryza sativa (japonica cultivar-group)]
Score 226
Evalue 3.00E-57
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8670
TTTTTTTTTTGAAACGAACAATACAAGCACAGAAACTAAACAGACTTTTTTACATGGCTAATAAGTAGTATCACTACAAAGGGAAACGAAGTACTGTAGT
ACACAGGTGTCCCCAGACCGAGCAGCAAACAGACTATGCCAACGAGTACAGCAAGGAAGTCCTCGAGTGCTACACGGTAAACAGCACTCAAATGGCTCCC
AGCGGAGTACAGCAAGAAGTCATCAAGCGCTACACAGTAAACAGCACACGAATGGCTCCGACAGCATCGACGCCGTTGGCGTTGTTAGTCTTGTACAAAC
TACGGCTTCACCGACGTCTCGAGGGGCGTATATGAGACGACCCTCAAAAAGGCAGGGACTGTTTTCCATCATGCCGTGCCAGCTATGGTAGCCGCATCCG
GCTTGGAGGTGTCTTTGTCCTTTCCTTCAGATGACCCACTGGGTGCTCCTGCAAACCTAAGGGCCCGTGCCTTTCGCTTCTCTTCTTCCGCCTTGCCAAC
TTCTGTGCTCTGACCAAATCGCTCTAAGCGGGCTTTTTTCTTAGCCTCGGTATCATCAGAGGAGGGCGTGGGAAGGCCAAACCTCTCAGCCCTGGACTTC
TTCTTCTGCTCCTCCATCTTTTCATTGGAAGATCCGGTCCCAAACCTCTCGGCGCGGCTGCTTCGCTTCTCGTCCTCGGACATCACCACCTGCGTCCCAA
ACCGCTCCGCGCGGCGCATCTTCTTCTCTAGATCCGTGGCTGCCCCACCGGCGGCGGCGGCCGCGGCAGGGCTAGGGTTTTGGGCTGCTGTCGGGGAAGT
GGGATTCGTCGCCTCCCCTGCGGCAGCAGCCGGCGGGGCCGTCAGCTCGGCGGCGGCCGGGACTTGCGCGGGCTTGGAATCCTGAGATGCCATCGTAGAG
CGCTCGTC
page-top