Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8667  (registered. 2012)
Contig Information
Length 595 bp
Clones alternative view 3 Clones [Download: TSV  ,  FASTA ]
WH_XB Root 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125491387|gb|ABN43180.1|| WRKY transcription factor [Triticum aestivum]
Score 161
Evalue 1.00E-52
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8667
TTTTTTTTTTAGAACACCAATGACAGATTTTTATTTTCCTTGACATAACAATATAATACAATGCGACGCCCTGGTGGCAAAAAGGAAATGGGGAAAAAAG
AATTGGGGTGAAGGGGGAGGCAATAATCTTATGTCCTAAATTTCAGACCTGCACTGAGGAAGAACTGGCGTGTTCTTCCCTCCTCTGTCCCTCAGAGGGT
GGTCACCTCCAGCTGCTTCTCTAATTTCTACTCCTCATCTTCTCTTTTCAAACATCTCATGCCAAGAAGACAGAAACGTCGAAGTTATTGACGTCCAAGG
CAGAAACGTCGAAGTTGTTAACGTCCAAGGCAGAATCGTCGAAGCTCCAATCGGACTGGAATGTGTAGAAGGCAGCCTCCTCCGTGCCGGCCGCCGGCAT
GCTCGTCGCCTCCACGAGCGCTGACACCATTGTTTGGAGCTCGGACTGCGCATGGAACGGGGTCATGCACATGTGGTTCGAGCCCGAGGTCGCCGGGAGG
GTTCGAGCGACGTGGGCATCGACACGAAGCAGTTCTCCGGCGTCGACGGCGTGGAGAACGGGTGGTGCTCCGGCGGCGTCATGCCGCCCTCGTGC
page-top