Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7803  (registered. 2007)
Contig Information
Length 780 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_14427 [Oryza sativa Indica Group]
Score 898
Evalue 2.79346e-105
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig7803
agctattgctgccTATCTGCTGGAAACGATGACTTTATTGGGACCATGATTGTGGAGGCCATTAACAAGGTTGGCCCTGACGGTGTCCTCTCCATTGAAT
CATCATCGTCGTTTGAGACTACTGTTGAAGTTGAAGAAGGAATGGAGATTGACAGAGGATACATCTCTCCTCAGTTTGTCACAAACTCTGAGAAGTCGGT
TGTTGAGTTTGAAAACGCTCGAGTTCTTGTCACTGATCAGAAGATTTCCTCGATTAAAGAAATCCTTCCTTTGTTGGAGCAAACTACGCAGTTGAGAGCA
CCACTTCTCATAATTGCAGAGGATGTATCTGGTGAGGCTTTGGCAACTCTAGTTGTCAACAAGCTTAGAGGAATTCTGAATGTAGCTGCGATTAAAGCTC
CCGGTTTTGGTGAAAGGCGCAAGGCTCTCCTTCAGGACATTGCCATTGTTACAGGTGCTGAATTTCAAGCCAAAGATCTTGGGCAACTGATCGAGCAGAC
AACAGTGGAGCAGCTCGGCATAGCCAGGAAGGTGACAATCTCCGGGTCATCCACAACCATAATAGCAGATGTTGCCACCAAGGATGAGAtccaggctaga
attgcacagctgaagagagagctttctcagacagactcgacatatgattctgagaagctggcgggagagaatagcaaagctctctggtggagttgctgtg
atcaaggttggagctgcaacccgagacggagctcgaggaccgcaagctccgcatagaggatgccaagaatgcaacttttg
page-top