Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8664  (registered. 2012)
Contig Information
Length 749 bp
Clones alternative view 8 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_yd Spikelet at late flowering 2
WH_XA Root 1
WH_XC Root, treated at 50 microM Al for 6h 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|238014948|gb|ACR38509.1|| unknown [Zea mays]
Score 221
Evalue 5.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8664
AAATGGTACATGAAAAGATTGATCCAATTCCTTCTCAAAATAAAAGTCATTTCAAGCATATTACTAGAAACCAGCAAGAGGTACATCTTCAACCAAGTAT
CCACTCCCAAACAAAATCTCTCACTACACAAACCTTGAACTTCTCTCAATCTCTGAACACTACAGATTTCTTTCACCTTTTTAGGGGATAGATAACACGA
CCCAACATTTGGGAGGACAAAGGCCCTAATGCAGGGAACCCTTCATTTACGCCTGAGCCTTCGCTTGTACAGCCTGCATCTTCTGTTGCAGCTTGATTAT
CGATTCCTTCTTGCTATTCTGTTTCTCCTCCAAGTCCTTGAGCGCCCGATCCATTCTCTCTAGCTCAGCCGTGATGTACTCGATGCGCTTCTTGATGTTG
GCCTTCGCCTCTGCATTGTCCTGCTTGACCAACACTGGCCCAATCAGCTTGTACACGTTTGCCCCTTCATTCAGCAGCTCCAGCTCCTTGAGGACGAGTT
CATTCTCGCCGACCTGGATGGTGAACTGCTTGCGGACCTCGTGGTTCTTGGAGATGTCTTTCTGGATCTTGCTGAGGGCGTTGGCCTGGGACTCAAGGTC
GCTCTGCATTTCACGTACAGCAGCCGGTGCCGTTGCCAACGACGACGCCATGGCTATCGCTGCTTCCTACGCCGCCTCCGGCTTTAAGCGTGGGAGTGCA
AATGTAGNTGTGGCGTCGTCTTCTCTGTTTCCGGGTTTGGGCTTTCTGT
page-top