Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8658  (registered. 2012)
Contig Information
Length 904 bp
Clones alternative view 11 Clones [Download: TSV  ,  FASTA ]
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XA Root 2
WH_XB Root 1
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125584693|gb|EAZ25357.1|| hypothetical protein OsJ_09172 [Oryza sativa Japonica Group]
Score 432
Evalue 3.00E-119
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8658
TTGGTATAGTAGTTCCACTACTTTCTCGTTTCCAAGGTTCAATTACATATTTTGCGCGCACATCCTGGCTGCGCGATTTCCACCACAAAAAACACTTGAT
GTTACACCACCATTTCACCTATAACATCGTCGCTAATCAGCGATAACCTGACCACCTTAGAATAAAACAATGCACCCGAAGAACGCTATACTTCAGCAAC
GTAGTATGTTCAGAGCTGCTGTTGCTGTTGTTGCTGCTGATCATTGCTTAGCATTGCCGAAAAGGGTCTGGAGAACGGTGTCACCTAGCCCGGGGACCGG
CGACAGGAAATGCCCGGTCGCGGGGAGCTCATGGTAGTTCACCCAGCTGAGCCGGCTGACGATGTGCCTCTGCAGCACCACGGGCACCAGGCCGTCCTCG
TCGCCCTGCCAGATGTGCACGGGGCAAGGCGGCTTCGGCAGGCTCATCGGGTCGAACTCCCACTTGCCGAACATCACCATCATGTCGCGGTAGTACGACT
CGTGGATGCCCTGCTGTGTTGCCAGTTCCATCTTCTGCTGGAATGTGCCATCGGCCTTGAGCTTGGCGCGGATCTCGGCGTCGCGCTTATTGGGGAGCGG
CGTGGTGCCGGCCACGACGGTGGAGGTGGGCAGCCAGCTCTGATCCATCCACCAGTGGAGGATGCCAGGGGCGTAATGTGACACACGCAGCGCCCACTGG
TCGCCCACCTCCTGCTTTTTGTACACCTCCGCGGCGAGATCCGCAGGGAAGCCCGGCCACCAGTAGTTCACCACCGGAGCCATCATTGCAGCTCCAGCAA
TCCTTTCAGGGATGTACTTGAGGGCGCCCCAGACAGCATGGCAGCCAAGGGAGATGCCGATCACGTAGAATTTAGGGCCTAATCCTAGTGCGTCAGCAAG
CTCC
page-top