Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8655  (registered. 2012)
Contig Information
Length 830 bp
Clones alternative view 15 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 1
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
Wh_SHDr Shoot grown with dessication 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 3
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|7711024|emb|CAB90214.1|| putative elongation factor 1 beta [Hordeum vulgare subsp. vulgare]
Score 440
Evalue 1.00E-121
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8655
CGCCTCCCCGCGGCCACACCTCGACTCGCTCCCTCCCTCGAGTAGATCATCTGTGTCATCCTTTTGAGGCGAGATGGCGGCTACATTCAATGTTAACGCT
GAGGCAGGCCTTCAAAAGCTTGATGGCTACCTTCTGTCTCGCAGTTACATCTCTGGATACCAAGCTTCCAAGGATGACTTGGCTGTGTATTCTGAGTTCT
CAGTTGCTCCACCATCGACCTGCACCAATGTTGCAAGGTGGTACAATCACATTGATGCGCTCCTGAAGCTGAGCGGGGTTACTGCGGCCGGTCAAGGTGT
GAAGGTTCTGTCATCAGTTGTCCCTGAAACCTCAACTACTGATGTTGCTGAGGCTCCTGCAGCTGATGATGACGATGACAGTGATGTTGACCTTTTTGGA
GAGGAAACCGAAGAGGAGAAGAAGGCAGCTGAAGAGCGTGCTGCCAAAGCAAAGGCTTCTACCAAGAAGAAAGAATCTGGCAAGTCGTCAGTTTTGCTTG
ATGTTAAGCCATGGGATGATGAGACTGACATGGTCAAGCTTGAGGAAGCTGTCCGAAGCATCAAGATGGAGGGCCTTCTGTGGGGCGCTTCCAAGCTCAT
GCCAGTTGGATATGGCATCAAGAAGCTTCAGATTATGATGACCATCATTGATGACCTTGTGTCTGTTGACACTCTGATTGAAGACCATCTCTGCGTCGAG
CCAGCCAACGAGTACATCCAGAGCTGTGACATTGTTGCCTTCAACAAAATCTAAATCTTCCNNNNNNNAGTGATGGCGGTCGGTGGACAATGCAGCAGCA
CAAACAATATATCTACAGTTTTCCGTTGCC
page-top