Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8643  (registered. 2012)
Contig Information
Length 842 bp
Clones alternative view 106 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 3
Wh_CSEC Callus 2
Wh_EM Dormant seed with water absorption 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_KMP Shoot grown under continuous light 5
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_OKCS Seed DPA5 3
Wh_PCDAM Anther at meiosis 4
Wh_RDr Root of dessiccated seed 2
Wh_SHC Shoot grown with cold treatment 2
Wh_SHDr Shoot grown with dessication 2
Wh_VABA Shoot with ABA treatment 3
Wh_VHS Shoot with heat shock treatment 2
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23 1
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 2
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_SP 4
WH_XA Root 7
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XE Seedling, infected with leaf rust 3
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 4
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27 ) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|195654829|gb|ACG46882.1|| ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 215
Evalue 4.00E-54
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8643
GGCAAGCTCGGAAGAACAATTCACAGCACATAGCAGATCACTAGCACCACAGCTCTGTAGAAATAGGCAGCGTAAACCCGGAAGCAAACAACAAACAGTT
GCTCAACGGAAAAGGCCCAAGAGCACAGACTTGTTCAGACTTCTATAGCAACAATTCCGTCAACCAAAACAAACTTTTATATCAGCAACAGCAACAGAAA
TTCTGTCGCAATTAATTTGGGAAGGGGCACGAGCTACAGGCCATGGACATGAAACCGGAAGGAGGAACAGTGTCATAATCTGCATTTTATTTCATGCATT
GTGATGCTACGAGGAGCAAAAGCTGTGGCGCATATCAAGGAAAAATGTCTTCAAGGAAGGGTTCTCTCGTAGAGGGGAAGGGCTCCCAGTGCTTTACGCT
CTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAATAGCTTTTGAATGGTGTCTGCAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCAT
GGAGAGGTCCATGGCGCGCTTGAGGCGCTGGTGGCGGGCGTCGACCACCTCCCGGGGCAGCCTGCCGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGG
TCGTACAGGTCGTCGTACCTCAGGCCGTAGTTCTTGAGGCGGTTGGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACC
ACGACGAGAACGCGGACAGCATCGACGTCATCCTCGGCGGCGGCGGCGGCGGCGATCCCCTTTCGTCTCCTCTCTTCTTCGGCGTTTGTGATTTGGCGAG
CGGAGGAGGGGAGGTGGGGGGTGGTTGTGGTTGTGGTTTCCC
page-top