Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7391  (registered. 2007)
Contig Information
Length 665 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 2
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os09g0567900 [Oryza sativa (japonica cultivar-group)] >gi|52077164|dbj|BAD46209.1| putative inosine-uridine nucleoside N-ribohydrolase [Oryza sativa Japonica Group] >gi|113632199|dbj|BAF25880.1| Os09g0567900 [Oryza sativa (japonica cultivar-group)] >gi|215692489|dbj|BAG87909.1| unnamed protein product [Oryza sativa Japonica Group]
Score 714
Evalue 1.10122e-73
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig7391
acatagctaggattaacaaacaaagaaggaagggaaggagctccaggaaagaggagggagacgaaattccgagagtggccgacggagagaggtttccatc
cacgaagcgatcgaccgggcgcgcggcgatcgatggcGGCGAACGGGCATCAGATCCAGCCGGCGGAGGaggagacGATGAAGCTCATCATCGACACCGA
TCCCGGCATAGACGACAGCGTGGCGATCATGATGGCGTTCCATGCGCCGGGCGTGGAGGTCCTAGGCCTCACCACCATCTTCGGCAACTGCACCACCGCA
TACGCCACCCGCAACGCCTTGATTCTGTGTGAGAAGGCAGGCCATCCCGACGTACCGGTGGCGGAGGGCAGCGCCGAGCCTCTCAAGGGAGGGAAGCCGC
AAGTTGCAGACTTTGTTCACGGATCCGATGGCCTCGGGAACGTACCTGTCCCTGCTCCCACCACCAAGAAAGCAGAGCAAACTGCGGCGGAGTTTCTGGT
CGACAAGGTGTCGCAGTTCCCGGGGGAGGTCTCCGTGCTTGCCTTGGGCCCTCTGACCAACATCGCATTGGCCATCAAGATGGACCCCTCCTTCGTGACC
AAGGTGAAGAAGATAGTGGTGCTGGGCGGAGCCTTCTTCGCAGCAGgaaatgccacgccttcggc
page-top