Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7194  (registered. 2007)
Contig Information
Length 770 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0170100 [Oryza sativa (japonica cultivar-group)] >gi|113531669|dbj|BAF04052.1| Os01g0170100 [Oryza sativa (japonica cultivar-group)] >gi|218187587|gb|EEC70014.1| hypothetical protein OsI_00572 [Oryza sativa Indica Group]
Score 578
Evalue 8.75549e-58
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig7194
gcgtatgACTctt*cgAACCCAACAAAAGAGTGGGCTTTTCCTGACCTATATGCCAACCCTAATAACAATTCAGATAAGCAGTCTACTGCATGTTGCCTG
TCTgatgtTGCTCATGAATCTTCTACTGGGGAAGGTGTTTCAGCTGCTAGTGGCAAGGAGCACAAGATAAATACTTATAGGGACAGGGCTGCTGAGAGAA
GAAAGCTACACCGCGGCTTAGGGATAGGACCCGGGCAGAAGCAAAGTAACGGCATGAGTTCTGATGAATATGAAGAGGCAACCGAGGACATGGACTCCTT
GGGAGCTGGACCAGTTGATATGAACTTATGTTCCAGTGGTTTGAAGTCTGCCAAGAGAATCATGGAGAACATGGGCTGGAAAGAAGGAGAGGCCCTTGGT
AAAAGCAGACAGGGTATTGTAGAACCTATACAGCCTACTTTCAACAAACATGGTGCTGGTTTGGGATGGAGTCAAACCCGCTGAGACGTTCTGATCTCTG
AACCCCTGTACATGGTGATTCCAGCGCACATTGTTTTTacctccggaggattggtgtaacagattcatggtcatcgcggcagtcctgactgttccaagga
cattgtattactaatgcagcaccagaggatactgtggaaaaatcgaatttcagcagcggttaccatggattcacgaagttcttactccttttgtgaccaa
tctatttcgatttgtaaatataacaagagaaagcatttgatgtgaggtcaaaatatctatctctattcac
page-top