Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig7112  (registered. 2007)
Contig Information
Length 1004 bp
Clones 3 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os02g0266100 [Oryza sativa (japonica cultivar-group)] >gi|50251962|dbj|BAD27897.1| putative u1 small nuclear ribonucleoprotein C [Oryza sativa Japonica Group] >gi|113536034|dbj|BAF08417.1| Os02g0266100 [Oryza sativa (japonica cultivar-group)] >gi|125581580|gb|EAZ22511.1| hypothetical protein OsJ_005994 [Oryza sativa (japonica cultivar-group)] >gi|215686377|dbj|BAG87638.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215707035|dbj|BAG93495.1| unnamed protein product [Oryza sativa Japonica Group]
Score 494
Evalue 7.61879e-48
Total Hit Count 242
Registered year 2007
Contig Sequence     [ Download ]
>Contig7112
ggtcgacgtcgccgtcgccgtcttttgccccgcgatgcctcggtattattgcgattactgcgacacttatctgacccatgactcgccatctgtccgtaag
caacacaatgctggatataaacacaaggcaaatgttcgtaactactatcagcaattcgaggagcagcaaactcaaagtttgattgatcaaaggataaagg
aacacctgggacaagctgcagcgttccaagttggcgctcctttcaaccaacatcttcttcaatatccaggaaatatgccccgtccccgtcttcCGATTCT
GCCCACACCCATGATGCAACATGGTTATCCTCAACATCAACAACCTGGTGGGCCATTTGCAAGGCCTCCTATTTTACCAGTTCCTGGGGCTCCAGGTTAT
CCTGGTGCTCCAACCATGCCGCAGCACGGGGGCCCTCCTGGTTCAATGCCTATGCAGGTGGCACCTCCCCCAAGGCCTCCGACACTACCACCTCCAACAT
TTGGGGCCCCAGGTGCACCCATGTCCAACAACGCATCACctccaggtcctccaccgatgtatcaaccaaatcaaccaccaACTGCAGGCTCAACTTCTGG
CGCTCCACCCCTGGCCCCAGCGGCCCCTCCACAGGCTGCATTCTCCTATGCACAATCGAATGAAGGCAACCACTGATCTGTtccttgGTGGTTAtcaaat
GAGATTCGAAGAACAGCCGTAACTTGGAAGTTGATGCTTCCTGCCTGTCTGTCtcctgaATTTCGGAGGCAGtctgtCTCTTGAAATTTGGAGAATTGTT
AAGAAAGGCTTCCTGCAgtagtATTTTTTGTATTTTAGGTGGTGTAACCTTtacttctTAATACACCGACTTCGTATTAGTTTCTTGCCCTTGAAACTTG
ATAATGGATATAACCCATGGATGGCGTACTTGATGTAGTACAtatttgTCATTAAAACAAATTtatttgttgaaaaaaaaaaaaaaaaaantttaaaaaa
aaaa
page-top