Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6816  (registered. 2007)
Contig Information
Length 622 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_25004 [Oryza sativa Indica Group]
Score 1014
Evalue 1.52882e-108
Total Hit Count 176
Registered year 2007
Contig Sequence     [ Download ]
>Contig6816
aagaagcactaactgttgggcaattaaaggaagcagcaaacaaggcccacaacgcAGAACTGAAGTTGTTCTTGGAAGTTGAACTTGGGCTGGACCTAAA
ACCTCTTACTCTACCAGACAAGACCAGAGAGGATATTTTGCTTTTCTTCAAACTCTATGATCCTGAGAAGGAACAGCTGAGGTATGTTGGTAGGCTCTTT
GTGAAGGCTTCAGGAAGACCACAGGATATTCTGCCAAAATTGAGAAAAATGGCTGGTTTTTTGCAAGATGATGATGTTGAACTTTACGAGGAAATTAAGT
TCGAGCCAAATGTGATGTGTGAATACATTGATAATAGGATTATATTTCGCTCTTGCCAGCTGGAAGATGGTGATATTGTTTGTTTTCAAAAATCCCCAAA
GCCAGACACTGCCGACCAGTTTAGATACCCTGATGTCCCATCGTTTCTGGTGTATATACGTAacagacaggttgtccacttccggtcgttggagaagccc
aaggaggatgatttttgcctagagatgtcaaagattttcacgtacgatgaagttgtagaaaaagttgctcaacagcttggtgttgatgacccatcaaaaa
ttcgtcttacatcacataattg
page-top