Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6815  (registered. 2007)
Contig Information
Length 539 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012813 [Oryza sativa (japonica cultivar-group)]
Score 84
Evalue 0.73759
Total Hit Count 15
Registered year 2007
Contig Sequence     [ Download ]
>Contig6815
ggcccctccgctagacAAAAAGCAGTTCAATCCCCAGCCTCTCCCCACGGCCATCAGGAGGAAGCCGAGCAGAGCAGGGTGTCTCCAGCAGGAGAGGCGC
TGGTTCCGCCAGATCGGTTGGCCGCGCTCTGTGGGGATGGCCCGATGGGGAAGATGGAGAGACGACGAGTTTAGGAGGCGCATCGCAGGGCCTTGACCCT
CTCTTCTCTGTAGCACAGGGTGAGGCGGAGAGCCCAACCctctgCTCGAGGCCTCGGCACCCCTCTCctcttccaccgtcgctctgataggggaggacat
ttatgtttgagagagagggatggaaaagtggggatggattaagacaagaggaaggaacgcttatcctgcagttggagcaccgtcttctatgcttctgctc
acagtcccaacatcctcatggcaggtccaaatccctgaggtttatgaccttgattttgccatagaggtagtagaagcagatatagtgcaagaagccgacg
cactcataatgtacaccccatcacctgagggaaagagag
page-top