Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6805  (registered. 2007)
Contig Information
Length 510 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein CNBE5030 [Cryptococcus neoformans var. neoformans B-3501A] >gi|50257882|gb|EAL20583.1| hypothetical protein CNBE5030 [Cryptococcus neoformans var. neoformans B-3501A]
Score 87
Evalue 0.282402
Total Hit Count 57
Registered year 2007
Contig Sequence     [ Download ]
>Contig6805
cccatctcgccgctgccagacctaaccctcgcctccgccgccagacctaaccctcgccgccaccgctgccgcCGCAGCAGCGGTCGCCGCCTTTGTCGTC
CCACTCCGCTGCTCCAGGCCGGCGCATCCACCCTTGAGACTGCACATCCCCTCGTTTCTTGTACCTTCTCTATCCTCTCGCCGGTCAAGCGAACCACACC
TTGTCCTCCTCGCGCCTACGCGCAGCCTCACCACGAGCCCGAGCGCGCCTTCCTCACATCGTCACCACCGTCGATCCTCCACACCAAGAAGCCGGCGGCT
ACTTTCTGTTGAGAGACGCATCctgaacaatgagagaccaggtgagtggtggctccatggacatggagtactatgcatcgggttgacgaactctccaggg
cgctcaccgatcttggctttttgttctgaccttgtgtacatgaaggcacatggatcacctaatttcaactctgacgcagagcaataaaatgatttaggaa
agcattgagc
page-top