Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6785  (registered. 2007)
Contig Information
Length 419 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unknown [Zea mays] >gi|194706350|gb|ACF87259.1| unknown [Zea mays] >gi|194708116|gb|ACF88142.1| unknown [Zea mays]
Score 145
Evalue 4.52859e-08
Total Hit Count 52
Registered year 2007
Contig Sequence     [ Download ]
>Contig6785
aggggcaacgccaagtacaccgactgcgcgtacccttgcgacggcacatgccatcaccttgtgttcaaggggaggcatctctaatatgatcatatccttt
gacaccagcagctgaagtgctgaaaacccagtgagtgggcacaacCGAAAAAaggagggtATAGATAGAAGATGGGTGCAAGTTGGTGGCTTGCCCGGCG
TCCATCgcctgAGATAAGATATGATAGGGCAGGGCCTCGCATGCAAACGCTACGAGGCCCTCTGCGTTATTTTAGCTTCACATGTTGATTCTTTCCATTT
gccaatTGTTATTCGCTCGATGTATCTGAATATTTGgaccacACTGGTGTATAACCTTAcatattcatgtattgaatgtgataatatgaatgaataatgt
gcttagttcaaaaaaaaaa
page-top