Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8554  (registered. 2012)
Contig Information
Length 905 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_OKCS Seed DPA5 1
Wh_SHC Shoot grown with cold treatment 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242089771|ref|XP_002440718.1|| hypothetical protein SORBIDRAFT_09g005570 [Sorghum bicolor]
Score 258
Evalue 9.00E-67
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8554
TTTTTTTTTTGCAGGAATTGAAGAAAGCTCTTAATAATAATATTGTTTCCGTAGTGACCAAAAATTTCTGAATCGCTATGGGCCACCGTAGATAAAAATT
ACAACGTTATGGACCATCGTCATTAAAAAAATACACTGGAGACCATGGGTCACCAAAACCTCGACGAATGCCCTTACCCTGCATGCATCTGCCAAACGTC
GTCAAAGAAAAGACCGCTTTTGAAGGGACAAAGACGTCTAGAAACACTGCAGAACTCTCCATGTTCTACTCATATCCTCACAACGTATGAAAACAACCAT
TCCTGCTAGTCTATTGCCCTAGCAGGCAAAAAGCACAAGAGAACCCAACCGATCATGGACGTAAAATCTCACTGGTCGACAGTTCTTAAACCTGGGAAGG
ATCATCCTTATCAGTGTCCATTTGCTCAGCCGCATGCTCATCCTGAGCACCGTCGCTAGCTGGCTCAGCGGACTCATCGGCTCCATTTGATTGTTGTTCC
GGTGTATGAGCCTCGGGTGATGGGGTTTCTGCTGGTGGCGGGGTCTGGGGCTTTGGCGCTGGCCTTGGTTTGGTCATGATGGGTTTGCAGAACCTGTCAA
GCGCTTCAGCCTTCTTCTTTATGTCAGAAACAAGTAGGACGGGATTAGCATGCTTCGGTAGAGCATCTTGCTGCTGCTTTTTCTCCATTAGCCAGGTCTC
TGCGGCCGAGCACTCATTAACGACCTTTTGTTTCTCTGATATGTCTATGTGATCAAACTTTTGGTCAGCAGACAATGCAGCCTCTCTAAAACTGCGGATG
CAGTACACCAATTGCTCAAGAGCTGGACCTCTTTCTGTCCACTCTTTGTAGCGCATTTCGATAGGACCANNNNNNTTTTTCAGTTCTTCTAGTTTTGCAA
CATAG
page-top