Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8522  (registered. 2012)
Contig Information
Length 1120 bp
Clones alternative view 7 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_RDr Root of dessiccated seed 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125545397|gb|EAY91536.1|| hypothetical protein OsI_13169 [Oryza sativa Indica Group]
Score 401
Evalue 9.00E-110
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8522
TTTTTTTTTTGCAATTAAACTGCTTTGATTTGCATCGCTTTACAACACGGTGCTGATCAGAATTATTTGTCTTTACAATTAAACTGCTTTGATTTGCATC
AGCTACTAGTAGGCACTTACTGTACATGCATATGAACTGTACACACACATAATTAATTATGCATCAGAAATCAATCAGAATGATCACATAGACATTATGG
ACATGTTGCGTCTGGATTGGAGCTGTTGGAGATGAGGACGATCGATCAGGCCTGGATGGAGGTGGGCTGGATGACGGCGTCCAGGTCGGCCCTCATGCTC
TTGTTCTTCTCCACGTTGTGGTCGGGCTGGAGCTCGCCGTCGCCGCCCCAGATCTCCGGGATGGCTCGCCGGAGGCCGCCGATGCTCTCCAGCGCGTAGT
CCGCCTCCTTGCTCCTCGCCCTCTTGCCAACCAGGGCCGTGCGGAGGCCGAGCGCTTTCCCGGCGGCGATGTTCCTCTCGCTGTCGTCGAGGAAGAGCGT
TCGGCCTGGGTTTGTGCCGGCGACGCGCAGGGCGGCGACGAAGGCGTGGACGGACGGTTTCAGGACGACGGCGGGGCGGTCGACGTCGGCGGCGGCGGCC
TCGTCGTCCTCGCCCTCCAGCTCCTCCCCGAAGAGGTGCGGGTTCATGGTCTCGAAGCACACGACGCCGTCGAAGCAGGCCTCGTCCACGCCCAGCCGCT
CCAGCGCCCGCTTCATGTGCGCGCGGTCCGAGTTGGTGAACAGGATCTTGCGCTGGGGCATGCTCTGGAGCGCCGCCGCGAGCTGCGGGTCCGTGGTGAT
CACGTCGTAGGGCAGCCTCCCGTGCACGTAGCTGTGGTACTCGTCCGGGTGCACGTCGTGGCCGAGCGCGACGAGGCCGGCGAGGGTGCTGCCGTGGGAG
CGGAAGAGGTCGGCGCGGAGCGCGGCGGCCTTGTCGGCGGCGAGGCCGAACCTGGCGACGAGGAACTCGTCGATGTTGCGCCTCAGCGCTGGCCCAATGC
CGGTGTTGCCCGGGTACAGCGTGTCGTCGAGGTCTATGAGGAGGCAGTCGAAGGGGGAGCCGACGGGGGACTGGAAGGCCATGGCCGGAGAGCTAGCCGC
GAGGAGCAGGAGGCGATCGG
page-top