Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8509  (registered. 2012)
Contig Information
Length 1868 bp
Clones alternative view 50 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_r Root 3
Wh_DPA20 Seed DPA20 1
Wh_EMI Dormant seed with water absorption after breaking 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_RDr Root of dessiccated seed 2
Wh_VSCB Liquid cultured tissue 4
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 2
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 3
WH_XT Roots, 18 day old plants were grown hydroponically 5
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 7
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 7
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473713|ref|NP_001060455.1|| Os07g0645400 [Oryza sativa (japonica cultivar-group)]
Score 991
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8509
TTTTTTTTTTTTGAGGATAGTCATTCTTTATAACATTATTAAAGAAGAAAAACAGGCTCATGTAACATACAAGGTACAATCCTTCAAATTCGTTTCTACT
TCTCCATCAAAGCACACAAGGCTTCACCAGCGCATCAAATAAACATGGACATAAAAGGTTCGAACCAATAAGGTAAGCTACATCTGCTTGTACAGAAGAG
CTTCACCGGTTTGCATTATTTCTGTGAATAAAATCAGGAAAACAGAAGTGGTGCTCATGCAGAAGCTGCCATCAGCAGCTCGCTATCAGCTCGATCGCGG
ATCCTCCTTTCCAGCTCAGGCCTGAAGTGCCTGATAAGACCCTGCACAGGCCATGCTGCAGCATCCCCGAGGGCGCAGATTGTGTGGCCTTCAATCTGCT
TCGTCACCTCCTGAAGCATATCGATCTCTTCTAGCTTTGCATTGCCCACTTTGAGCCTCTCCATGATCATCCAGAGCCATCCTGTACCCTCACGGCAAGG
CGTGCACTGCCCACAGCTCTCATGCTTATAGAAGTATGACAGTCTAGCAATCGCATCAACTACATCTGTGGATTTGTCCATCACCATAACTGCTGCAGTG
CCTAATCCGGACTGTACAGCCTTTAGTGCATCATAGTCCATCAACACGTCATCACATATGTGCTTTGGCAACAAAGGAACAGATGAACCGCCAGGGATAA
CTGCAAGCAGGTTGTCCCATCCTCCTCTCACACCTCCGCAGTGCTTCTCGATCAATTCCTTCAGAGGTATACTCATTTCCTCCTCAACGGTACAAGGTTT
GTTCACATGACCTGAGATGCAGTAAAGTTTTGTTCCCGAGTTATTCTTGCGTCCAAAACTCGCAAACCATTCTGGGCCACGCCTAAGAATTGTTGGAGAC
ACAGCAACAGTTTCAACATTTGTGACAGTTGTGGGGCAGCCATACAGCCCAGCATTGGCAGGGAAAGGTGGTTTCAGCCTTGGTTTACCCTGCTTGCCTT
CAAGGCTCTCCAGTAGGGCAGTCTCTTCACCACAAATGTAGGCACCAGCACCAAAATGTATATGTACATCAAAATCATAGCCTGACCCGCAAGCGTTCTT
ACCAAGAAGTCCTGATGCATATGCTTCCTGCCGAGCTTTCTCAAGGTTCAGACGCTCATTCACATATTCACCTCGAATGTAGATGTAAGCAGCTGATGCC
CTCATTCCAACTCCAGCAATCAGGCAACCTTCCAGAAGCTTGTGGGGGTCATGGCGCATGATTTCCCTGTCTTTACAAGTTCCTGGTTCACTCTCATCAG
CATTAACAACAAGATAAGAAGGACGTCCATCAGACACTTTGGGCATGAAAGACCATTTGAGGCCAGACGGAAAACCTGCACCTCCACGCCCTCGTAGACC
TGATTTCTTCATTTCATTCACTATCCAATCTGCCCCTTTAATCACTAAATCCTTGGTTCTATACCAATCACCTCTCTTCATTGCACCTTTCAGAAAAGGG
TCATGAAGACCATAGAGGTTGGTGAAAATACGATCTTCATCTTTAAGATCACCAAAGTGAGTCTTCTCTGGAGGTGGGGGTGGTGGTGGAGGCTGTGGTG
TGCTTGATGTAGTAGCAGCCTGGGTGCTGAATGATCTGCCAGCAGGATGCAGGCCGGCACATGAGATAGAACTAGTAGGCTGTGCCTTTGATAGAGAATG
CAAGTACTCAAGTGCAGCCTTGCGACCGGGAGAGATCTCCGCCGATCTGAGCAGCGCCCACCGCAGCGCCATCTCCGCCTCCGCTTGGCCTCGAGTCCGT
CGGATTTGGGGAAAAACCGGGGAGAGGCTAGTGTGGTGTGGGGAGGAGAAACGGGGCGAGCTCCAGGC
page-top