Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8504  (registered. 2012)
Contig Information
Length 974 bp
Clones alternative view 37 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 5
Wh_RDr Root of dessiccated seed 1
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 4
WH_XT Roots, 18 day old plants were grown hydroponically 12
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 6
WH_XA Root 2
WH_XB Root 2
WH_XD Root, treated at 50 microM Al for 6h 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|283806406|dbj|BAI66435.1|| tonoplast intrinsic protein [Hordeum vulgare subsp. vulgare]
Score 489
Evalue 3.00E-136
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8504
GTGGTACAGACAGTAATTTTCCAGGGTAGCAAGAGAGAGTGAAAGCAGAATGGTGAAGCTCGCATTCGGGAGCTGCGGTGACTCCTTCAGCGCCACGTCC
GTCAGGGCGTATGTGGCGGAGTTCATCGCCACCCTCCTCTTCGTGTTTGCCGGCGTTGGGTCCGCCATTGCCTATGGGAAACTCACCGATGATGGCGCGC
TCGACCCGGCTGGCCTTGTGGCGATCGCGATCGCCCACGCCTTCGCCCTCTTCGTCGGTGTCGCGATCGCTGCCAACATCTCCGGCGGCCACCTCAACCC
CGCCGTGACCTTCGGCCTTGCCGTCGGCGGCCACATCACCATCCTCACCGGGATCTTCTACTGGGTGGCCCAGCTGCTCGGCTCTACCGCCGCCTGCTTC
CTCCTCAAGTTTGTCACCCACGGAAAGGCCATCCCGACGCACGGTGTGGCGGCGGGCATGAACGAGTTCGAGGGCGTGGTGATGGAGATCGTCATCACCT
TCGCGCTGGTGTACACGGTGTACGCCACGGCGGCGGACCCGAAGAAGGGGTCCCTCGGCACCATCGCGCCCATCGCGATCGGCTTCATCGTCGGCGCCAA
CATCCTCGCCGCCGGCCCCTTCAGCGGCGGCTCCATGAACCCTGCCCGCTCCTTCGGCCCGGCCGTCGCCGCCGGCAACTTCGCTGGAAACTGGGTCTAC
TGGGTCGGGCCTCTCATCGGAGGCGGCCTCGCCGGGTTCGTCTACGGCGACGTGTTCATCGCGTCCTACCAGCCAGTCGCCGACCAGGACTACGCGTAAA
TTAGCGCGTGAGCCGAACGCTCGACCCGTCTCGGATTTGCATCGTTGCTTTGCTCTTCGTCATGTGATCTGATGGTCAAGGTTGTGTACAAATGGTGTGT
CACGGTCACGGCCTTTGTGTTTCCCTTTCGATTCAATCCATGTAAAATATTTTCGTTCGGCAGCCCTCGTTTGT
page-top