Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6049  (registered. 2007)
Contig Information
Length 1027 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0926200 [Oryza sativa (japonica cultivar-group)] >gi|57900128|dbj|BAD88190.1| zinc finger (C3HC4-type RING finger) protein-like [Oryza sativa Japonica Group] >gi|113534791|dbj|BAF07174.1| Os01g0926200 [Oryza sativa (japonica cultivar-group)] >gi|215707113|dbj|BAG93573.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218189648|gb|EEC72075.1| hypothetical protein OsI_05009 [Oryza sativa Indica Group]
Score 1088
Evalue 1.03892e-116
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig6049
gaaactccgcagattctcctcgccgctctccatccggccgtccctggacggtcaccatcgccgaccgccctcccgacgaagcatcgaccccttcccgccg
ccgcctgcctcgtcgccggcgcatgagagtgaatcatgggagggttttgctgctgcctttccacagatgattttgaggaatatgttcatccaaataatcc
tgtctataggcaatgcatatccctaaggcatttgttccagaacatgtttggagggtatactgcagcatttcagaggctcgactctaggccaagcaaccca
gctcaaggagcTGCGCCATTGGCATCCACTAATCCAAGTACTAATATAACTGAGAGTTCACTGTCTGAAACTTTTCACCTTGTTTCTAGACCACCCCCAT
ATGACATTGACCCTAGATATGCCCGAGTTCAAAGAGAGGGACTGGTATCAAGGCGTGAAAAGTCTATAAACCTCACGCATGAAGAGTCCCCAGCTCTTAG
ACGAAATGGCAGCAGCTCTGGTGTTGAACATTTAGCTGCTCAAAAGAAAAGGAGCAGCACTGATCCTGAGGGTGAACATAAGGTGCGTCGTTCTGAGTCG
ACTAAGAGTCTTTCTGGAAGAGCATATAACAGCAGTTATGCCGTCATCActtcagacgacgaagatgtctgccctacttgtctggaagaatacaccccgg
agaatccgcagatcataactaaatgctcccaccatttccatctaagttgtatttatgagtggatggagagaagcgacacctgcccgatttgtgggaagga
aatggagttctgcgagagcccctgagagaaacttccatgctggtcgcatcaggaagagcgggaaaaggtatctgcagcatgggatgctgaagagtctgta
aagggaagaagtatctacagcatgggatgctggagcctgtaaataataccgtagttctttgctgtctgaaacctgtnctcgttnctcgagaccgacttgt
gtgtacnaaatcaatctaccaaaaagt
page-top