Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6044  (registered. 2007)
Contig Information
Length 625 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit cytosol aminopeptidase [Oryza sativa (indica cultivar-group)]
Score 595
Evalue 5.96742e-60
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig6044
aggaattcggcacgaggcTGGTGCCTGCGTTGTTGCACTTGGGCCTAGCATTGCTGGAATcttcacACCAAGTGATGAACTAGCCCAGGAAGTCGCCGCT
GCATCTGAGTTATCGGGGGAGAAGTTCTGGAGATTGCCCATGGAGGAAAGCTACTGGGAGCAGATGAAGTCTGGTGTGGCCGACATGGTCAACACCGGTG
GTCGACAGGGAGGCTCCATCACCGCTGCCCTGTTCCTTAAACAGTTTGTCGACGAGAAGGTTCAGTGGATGCACATCGACATGGCGGGGCCGGTGTGGAA
CGACAAGAAGCGTGCCGCCACCGGATTCGGCGTGTCCACCCTGGTGGAGTGGGTGCTCAAGAACTCATCATCCTGAATGGACATCCCCCCTGATTTCCAT
TGGTtc*tgATAACAACGCCAGAGAAGGAAGAAAAACAGAGTGCTGTTCATTCATGATTGTACCAGGGAAAATGAATGGATTTTATTTGCTTTTGGCTGG
CGTATGGACTATGGAGGGGAGCGATAGAATAAGGAAGGGTTTCATGGAGGAAAATAAAACAGAATCAGAATGTCGTTGAACACTTCCCTTGTCAGATtaa
atggtGTTTCATCGTTTTCAtgttg
page-top