Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig6037  (registered. 2007)
Contig Information
Length 628 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os08g0277200 [Oryza sativa (japonica cultivar-group)] >gi|37805889|dbj|BAC99738.1| putative cinnamoyl-CoA reductase [Oryza sativa Japonica Group] >gi|113623404|dbj|BAF23349.1| Os08g0277200 [Oryza sativa (japonica cultivar-group)] >gi|215741225|dbj|BAG97720.1| unnamed protein product [Oryza sativa Japonica Group]
Score 702
Evalue 2.3657e-72
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig6037
gcTGCTATGCGAAGACAGTGGCGGAGCAGGCGGCATGGGAGCTCGCCAAGGAGAGGAAGCTCGACCTTGTGGTGATCAACCCGTCTCTAGTGTTGGGCCC
TCTGCTACAGACGGCGGTGAACGCAAGTACGTGGCATATTGCCAAGTATCTGGACGGCTCGGTGCAGACGTATGCCAACGCGGCGCAGGCGTACGTGCAC
GTCCAGGACGTCGCGGATGCGCACACGCGTGCGTACGAGACGCCCGACGCGCATGGCCGGTACCTTTGCGCGGGGCGCACGCTGCACCGCGGCGAGGTGT
GTCGTATCCTCGCCAAGTTCTTCCCAGAGTACCCCGTGCCCACGAGGTGCAAGGAAGGGACGCGCGAGATGAAGAAGGGGTGCCGGTTCAGCAGCCGGAG
GATCATGGAGCTCGGCGTCGGCATCACGCCAGCGAGCCAGTGTCTCTACGACACCGTCACCAGCCTTCAGGACAAGGGCATCTTACCCCGTCGCCACGCT
GATATGTCCTGACAACTTCGTGGTCACCTTGGTCAAGTTAACTTGCTGCACGCATGCCCgtttgaTATTACAAAGTCGTGGCATTGAATTCTTTATGTAC
TtcttaTTTTCTCATCAATTAATAtaaa
page-top