Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8449  (registered. 2012)
Contig Information
Length 951 bp
Clones alternative view 27 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 2
Wh_CSEC Callus 2
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 1
Wh_VHS Shoot with heat shock treatment 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XA Root 2
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 5
WH_XD Root, treated at 50 microM Al for 6h 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|224035479|gb|ACN36815.1|| unknown [Zea mays]
Score 429
Evalue 2.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8449
AGTGACCAATTGTTTGACCAGATGGCCAGATCTGGACAACAAAACACACAATACAGCTCAGCTTCAAATAGAAAAGGGGATCTTATTCTTCATCCAATCA
AAAGTTCGGTATACCAGGAATTCGGTGACACAAAGATAATAATTGACGGGGGCGACAATGAATAGGAGCACTAGAATCTGCTAAAAATCGCGCATGGGGT
AGGTAGGACAGGCTGTGCTATTCTCTCTGAATGTCTTTGCAAGGAAGGCTCCGATCGATGGGCAGTGGCGCATAATAGGCCTGGCGTTGATCTGCATACT
TGTTTACTCCTTGCCGTCAGCCGCGCGGAGGGAGCCCAGCTGCACGGGCGCCTGTGTGGACACCACCTTGGACGATCCATACAGGGCGACGTCCTTCCCC
TCGGTCCTCTCCTTCTCAATCTGCTCCTTGATCCAGAAGTAGGTGAACCTTAGGCCATCCTTGAGCCTCATTGTGGGGGCCCACCCAAGCTTCTCCTTGA
TGAGGGTGTTGTCAGAGTTGCGGCCACGGACACCCTCTGGACCAGGGATGTGGTGGATGGGCAGCTTCTTGTCCTCGAAGCCGAGAACAATCTCAGCCAT
CTCGTTCATGCTCACCATTTCATCGCTTCCGATGTTCACGGGCTCGCAGAAGTCCGACTTTGTCAATCTCAGAACACCCTCGACGCACTCGTCGATAAAA
GTGAACGATCGAGTCTGGAGACCATCACCCCACATCTCGAACTGTTCGGTGGAGGTCTGAGCCTTTCTACAGAAGGCAGCTGGTGCCTTCTCGCGACCGC
CTTTCCATGTTCCAAAGGGACCGTAAATGTTGTGAAAACGGCCAATACGGCACTCGATGTCAAAGTCCTTGGTGTAGTGCTTGCACAGCTCCTCGGTCGC
GAGCTTCTCCAAGCCATAGGCATCTTGTGGCTCAGCAGGCCAGGCATCAGC
page-top