Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5600  (registered. 2007)
Contig Information
Length 394 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit unnamed protein product [Vitis vinifera]
Score 384
Evalue 8.75415e-36
Total Hit Count 465
Registered year 2007
Contig Sequence     [ Download ]
>Contig5600
gaaaaggaAGCAGGAAGAGCGTGAAGCTGAAAGACGACAGGACGCTGAACTTGTAAGGATGCAAGAGATTGGTGCCTTAAAAAGAGAACAAGCTAGGCGT
GCCACAGAACAGAAGATTTTAGAGCAAGAGCTACAGACTCTGAAAGAAAGGGCTAAAAATGATcgcgagacaaacaaagagaatgctatttctaatgcta
aagctaaagctcatgaagcaaagctgacagaagattacgaaagaagaatgcttgtggaactcatgaatggcgaaagagaaaagtggcttgctgcaataaa
taccacctttcaacatatagaaggtgggttaagaacattattgactgataggagtaagcttgtaatgggtattggaggagtcactgcactagct
page-top