Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5592  (registered. 2007)
Contig Information
Length 468 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_012444 [Oryza sativa (japonica cultivar-group)]
Score 76
Evalue 4.6615
Total Hit Count 4
Registered year 2007
Contig Sequence     [ Download ]
>Contig5592
ttcggcacgaggcGGTGGCTCATCAGATCTACTCCTCCGCCACCGCGCAATTAAGCCAGCACAGTCCACGCCAGGAAAACCGTACGCACGCAGCAGTATA
GCCGCACGCCGTCCAGACGGCGAGGAGGCAGCGGCGGCAGCAGGAGGGTCTCGCAGTACGCGTCCTAGCCTCCTATAGGCCTCACTGGGCCTGGCGAGAG
AGATGAGTGCGGTAGGTCGTTGAACAACCTGAAACTGTCGAAATGTCATAGAGTCGCGGCAGAGGGCTGGTATGAAGGAGACCGGTGAAATGTCATAGAG
TTGCAGCTGACTGTGTGTGTGTGCGACTGTTGGTTTTTTCGTGTTGTTTGTTGGTTCTAGTAGCTTCATAAATTGTGTGGCGATTTTGTACATATGATCA
GTCATGCGTattggtCATTCCTGGGATGATAGGGGAACAGCAAtgtatttgctgttttggtttttggt
page-top