Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig5586  (registered. 2007)
Contig Information
Length 816 bp
Clones 2 Clones [Download: TSV  ,  FASTA ]
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17819 [Oryza sativa Indica Group]
Score 678
Evalue 2.4605e-69
Total Hit Count 431
Registered year 2007
Contig Sequence     [ Download ]
>Contig5586
gattgtgaagcagttatgggcatatatcaggcagaataatcttcaggatcctgatgacaaaaggaagattatatgcaatgatgaacttcgtattgttttt
ggaaccgactccactgacatgtttaagatgaacaaattgttggccaagcacataactcctcttgacccaaaagatcaaccttcggaagcaaaaaagatta
aggctgccactccagctcCTCAACAAATGCCTACTATAAATCAAAATCAGCCCTATGTGGTTGTTTCTGATGCGCTAGCCAAATTCCTTGGTGTAGAAGG
AACGGTGCCTCATGATGATGCCCTCAAGTACCTTTGGGATTACATAAAAGCAAATCAGCTTGAGGATCCTGCGAGTGCATCAATACTATGTGATTCCAGT
CTGCAAGAGCTGTTCGGCTGCGAGAGCATTCCAGCTTCAGGATTATCAGACTTGCTTGCTCACCATTTCATCCAAAGGACATAGCATATCCTCATTAACT
GATGTAGGATCGCAGCGGTGCCAGATAGGCCTAACTTTACAGAAATGGTGTTCTTACAAAATGGACAGCGTAgcttgtgtatctccccggcgttccggat
tatggactgcgtcagacaaaagtcagattatttgtggtagcctgtaacttgccatgtgtgtgtattggctgccgcccagtatttggttggtgtaactcgc
actgagttgttgttagctttagtttctgagtgtcaaagtgtctttactgactatgtaaagttatgctttatatctgagtgccagattgaattgaatttta
gttttctnataaaggt
page-top