Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8424  (registered. 2012)
Contig Information
Length 1546 bp
Clones alternative view 14 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_oh Pistil at heading date 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_PCDAM Anther at meiosis 2
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23℃ ) 2
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242038297|ref|XP_002466543.1|| hypothetical protein SORBIDRAFT_01g009680 [Sorghum bicolor]
Score 479
Evalue 4.00E-133
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8424
AGGTCAGCGACACCGGCGACGCAGCAATAACCCACTCCCGGCGAGGCTAACCACAAAATTGACCCTCCAATGGCGTGCGCGTGCTCCCCCGAACCCCGGC
TCATCGCAAGCGCGTGATTCATTCCGCGCAACCTCCATTTCCATTCCACAGCGTTGGTGCGGCGTTGCCTCCCCAGTCAGTCCGCCTCTCCCCCTCTGTC
TCTCTCGTGTTGTTTATTCTTGCGCCCCGACACGGCAGGAGGAGGAGGAGAGCACCGAGGTTGAGTTCCTTGCCGCCGTTCCGTGGGTGATTCTCGGAGC
CCGAGTTGCCGAGGTGCGGGTCCGGTTCGTCTTCTCCCTGGGGCCTCTTCTCCAGGTTGAGCCACAGTAAGTTGAAGACATCATGTTCCGTAGGAAGCAC
GCTTCTCATTTCAATTCAGATGATGCTGAGCAGCGACAAGCAAAGATCAACGAACTGAGAGCTGCACTTGGGTCTATGTCTGCCCGTGGCGAGAAGTACT
GCAGTGAAGCATGCTTGGCAAGGTATCTCGAAGCACGCAACTGGAATATTGACAAGTCTAGGAAAATGTTGGAAGAAAGTCTCAAGTGGAGGGCAGTTAG
CAGGCCTGAGGACATTCGCTGGCCTGATGTTTCTGTGGAAGCAGAAACAGGTAAAATGTACAGGGCAACTTTCACCGATAGAGAAGGGAGAACTGTCGTT
ATTATGAGACCTGCAAAGCAGAATACATCGTCTCATGAAGGGCAGTTGCGGTATCTTATATATACCCTGGAGAATGCAGTTCTCAGCCTGCCTCAGGGTC
TAGACAAAATGGTGTGGTTGATAGACTTCACAGGATGGACACTGGCCAATGCAACCCCCATAAAGACGGCCAGAGACAGTGCAAATATCCTGCAAAACCA
TTACCCTGAGAGGCTTTCTGTTGCGTTTTTGTTCAATCCCCCCAAAGTATTCGAGGCTTTCTTTAAGGTTGTAAAAGTGTTCCTTGACCCGAAATCGATC
CAGAAAGTCAACTTTGTGTACAAGGACAACGAGGAAAGCATGAAGACAATGTACAAGCACATTGACCCAGAAGTCCTTCCGGTGGAGTTTGGAGGGAAGA
ACATTGTGGTGTACAACCATGAGGATTACTCTAAGTTGATGACAAAGGATGACATCAAAACAACAAGCTTTTGGGCGGCAGATGGTAGCCATGCCGTAAA
CGGGGGCTCGGTGCCTCAGGTTATACCGCAGTCGTCGCCAATCGTTGCTAAAGCAAGTTGAGGAACATCTCGACGAGCCATCTCACCTGCTATTGCAAAA
GTAAACCGAGGAGCTTCAGCGAGCCAATGTCACGGTTCACAGCTCTAAAAGAGGAATATATCGATACCTTGAGGATGTTTGGATAAATAAATGTAACTGC
AAAATATCTCGCTTGTGATGTTACAAAAATAGTTATTACTAGTATATCCCCAAACAAGTGGTCTCACAACAGTTCCATATTCCCTTGGCCAACAATTTGA
AACACTAAAGAATAATTCACCTATTATTTAGCTGTCTTCCATCTGT
page-top