Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8416  (registered. 2012)
Contig Information
Length 725 bp
Clones alternative view 54 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 2
Wh_r Root 3
Wh_yd Spikelet at late flowering 2
Wh_KMV Shoot grown with continuous light after cold treatment 3
Wh_MS Seed DPA5 of DT3DL CS wheat 3
Wh_OKCS Seed DPA5 1
Wh_RDr Root of dessiccated seed 1
Wh_SHC Shoot grown with cold treatment 3
Wh_VHS Shoot with heat shock treatment 4
WH_XN Leaves, plant was grown at constant 23℃ 3
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XR Roots, 18 day old plants were grown hydroponically 3
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 2
WH_XA Root 4
WH_XB Root 8
WH_XD Root, treated at 50 microM Al for 6h 7
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig8416
TTTTTTTTTTGAAATGAAATAAGCATATTTGCTGGGTTGCTGGTCTGTTACAGCCATTGACCCAATACGTTCTAATAAAAAAACAAGTTACTTATAACTA
CCAATGGCAATGAGAGGGGACAAACATTGTCAACAGAATGATAAAGACTTCTCCATGGGTAATTAACTCATGTTCAACAATTACATCATTCAGTATCCAT
CAAAACATAAAGCCACTCTCGGAGTACAGAGCAAACATTACTGGAATTGTAATTAAGCCTTCTATTAAGTGCTCCATTCCTTCAACCCTGATCAGCATCA
CTTCAGGGTAGCAGGACCAGGTGAATTAACGGTACTTGATGAAGCCAATGTCCTTGGCGTTGCTGCGGAAACACTGCCTGCAGCACATCAGCCCATACTT
CCTGATCAGTCCATGGGAGTTCCCACAGACCCGGCAGACGCGGGAGCCGGGCCCGTAGTTCTTGGGGTGGGAGTTCCAGACGTTGGAGTGCCCCATCTTC
TTGTTCGCCTTCCGCCTGCCGCCGCCGGTTGCTAGGATGCGCGCCTCGTGCCGGCTTAACGACGGATCATCATCATGATCGATCCTATACTACTGGGGAG
GTGCGGGTTGGATGTTTCCCATTGTGTGCGTGCGTTCGTCTGGGCTTGGATGCCCTGCTATAGTGTTGGTGTGCTCAGATCAGATGTATCTCTCGTCGAG
CAGGGCTTGTACCTTTTCCTCGTGC
page-top