Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8410  (registered. 2012)
Contig Information
Length 512 bp
Clones alternative view 24 Clones [Download: TSV  ,  FASTA ]
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_SHC Shoot grown with cold treatment 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 9
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit (no hit)
Score
Evalue
Total Hit Count 0
Registered year 2012
Contig Sequence     [ Download ]
>Contig8410
GAAAGATCAACGGTAAAAAGTTGACATGACAAAAACACCAGCTCGCCACAAACAGGAATACAGCAGCCTCCACAACAAGAGCACTAGTATAGTATTTCTT
TTCAACGAGGCAACAGAGCACCAGTATTGGTCGTAGAAATGCAAGACGGTGAGTTTCCACGAACGAGAGCCCAGCCCAGGGGATGCACGCACAGTTTACA
CACTCCATTACAATCCTCCCATGGAGGAGGAAGAAGAAGACATTGCCAAAGATGTATAGTTGCCCTACACGGCCTAACACCCGCCTAGCTAGCTAGATAC
CTCCGCCGCGCACCGCCGTCGCCGCCGGTGAACCTGAGAGGTAAAGCGCAGCACGAGCTGCATGCCGGCAGTGGCTAGCATCAAGCCATTGTTGGGGGGT
ATATACCTGGGAGGAGCTCCTCCCAGGCGAAGGAGTCCTCCATGGGAGATGCCGGGTCAGGCTCCATATATAGAAGCGCACGCACGAGGTTTCGATCGAC
CAGCCCTCTTGC
page-top