Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig8403  (registered. 2012)
Contig Information
Length 1004 bp
Clones alternative view 141 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
WH_XJ Roots, two-week old seedlings treated with 150-mM NaCl for 6h (22℃ 16L-8D) 26
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 14
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22℃ 16L-8D) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 7
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XA Root 8
WH_XB Root 3
WH_XC Root, treated at 50 microM Al for 6h 41
WH_XD Root, treated at 50 microM Al for 6h 37
WH_XY Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|22038178|gb|AAG40562.1|| glutathione-S-transferase 2 [Aegilops tauschii]
Score 434
Evalue 8.00E-120
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig8403
AGTTCAATTTGTAAGCATTTTGCTTTTTTATTAAAAAAACTGTCGAACTCATCTCTTGAATCAGAAAGAGAACCTCAGCTAATACATGCACGCATTATAA
AATTTGGGAACTCCACACAAAAGCAAAATATTAAAAACTCAAGGACATAATCAATACTGAATAAATGGATGACATGAGTTACTGCTACATTATTACATCA
AGCAGCCAAACAAACAACATTTAAAAATAGCAAATTTTAGTTATTCTGGATGTGTGCTGGCTCAGTTAGACGGTGCAGCGGCAGCCTCTCGTGCCTTGGC
GAACTCAAGCAGCCTGCCCACGTCTGGCAGGGCCACCTTGGCCGCGTCGAGCTCGCTGAAGCGCTCCACCCATGCGGCCAGGAGCGGGGTCTTGGCGGCA
TCGAAGATCTTGTCACCGGACAACACCTCGGTCACCTTCATCCACGACAGAACGCCTCCCAGCGCAACGTCGACGAGCCCGAGGCCGTCGCCGCCGAAGA
AGCCCCTTCCCTTGGAGCATTCCCTCAGGGCCCCTTCAAGAATCTCCACCGCCGCGAACGCCTGCTTCTTTCCCTCGGATTTCTCCTCCTCTGTCTTGCC
CCTCAACCACTGCCTCCATGGGGCTACCAGCTTGTCGTCAACGTAGGCCATCCAGAAGCGAGCAATGGCGCGCTCGTAGGGGTCCGCTGGGAGAAGGGAC
GGGCCGGTGCCGGCGAACACTTCGTCGATGTACTGCAGAATGATCATGGACTCGCAGACCGGGGCGCCGTTGTGGATGAGCACTGGTATCTTCTTGTGCA
CCGGGTTGGACTTGAGGAGAAGCTCGCTCTTCTTGTACAGGTCCTCCTCCACGTCCTCGTAGCTCAGGCCCTTCAGGGCGAGTGCCAGCTTCACCCTGGT
AACAAACGGGCTTGGCCATGTGCCGAGCAGCTTCAGGTCATCTCGTCCGGCCATCTCTAACTACCTCGATCGATGTTTTGTGTGTGTGTGTGTGTGTTTG
AAGA
page-top